Miyakogusa Predicted Gene

Lj1g3v1720230.1

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj1g3v1720230.1 Non Chatacterized Hit- tr|B9SCP3|B9SCP3_RICCO
Cation-transporting atpase plant, putative OS=Ricinus
,51.49,1e-18,CaATP_NAI,Calcium-transporting ATPase, N-terminal
autoinhibitory domain,CUFF.27739.1
         (306 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC70231 similar to UniRef100_Q8L8A0 Cluster: Type IIB c...    92   2e-18
gnl|LJGI|GO007938 similar to UniRef100_Q8L8A0 Cluster: Type IIB ...    78   4e-14

>gnl|LJGI|TC70231 similar to UniRef100_Q8L8A0 Cluster: Type IIB calcium ATPase MCA5;
           n=1; Medicago truncatula|Rep: Type IIB calcium ATPase
           MCA5 - Medicago truncatula (Barrel medic), partial (17%)
          Length = 536

 Score = 91.7 bits (46), Expect = 2e-18
 Identities = 166/206 (80%)
 Strand = Plus / Plus

                                                                       
Query: 1   atggagagttacctgaatgagaatttcggcgatgtgaaggccaagaactcatcagaggaa 60
           |||||||||||  |||||||||||||||| |  || ||  |||||||||| ||  |||||
Sbjct: 28  atggagagttatttgaatgagaatttcggaggagtcaaatccaagaactcctctcaggaa 87

                                                                       
Query: 61  gcgcttcagcgatggaggaagctctgttggcttgttaagaatcgcaagaggaggtttcgt 120
           || |||||| ||||||||||||||||| || |||| || || | ||| ||| | ||||||
Sbjct: 88  gcacttcagagatggaggaagctctgtggggttgtgaaaaaccccaaaaggcgatttcgt 147

                                                                       
Query: 121 ttcactgctaatctctccaagcgatttgaagctgaagctatcagacgatccaatcaggag 180
           |||||||| ||||||  |||| |    |||||||  |||||  | |||||||||||||||
Sbjct: 148 ttcactgcaaatctcaacaagaggaccgaagctgctgctatgcgtcgatccaatcaggag 207

                                     
Query: 181 aaattcagagttgcagtgttggtttc 206
           ||  | || |||||||| ||||||||
Sbjct: 208 aagctgagggttgcagttttggtttc 233


>gnl|LJGI|GO007938 similar to UniRef100_Q8L8A0 Cluster: Type IIB calcium ATPase MCA5;
           n=1; Medicago truncatula|Rep: Type IIB calcium ATPase
           MCA5 - Medicago truncatula (Barrel medic), partial (6%)
          Length = 483

 Score = 77.8 bits (39), Expect = 4e-14
 Identities = 111/135 (82%)
 Strand = Plus / Plus

                                                                       
Query: 1   atggagagttacctgaatgagaatttcggcgatgtgaaggccaagaactcatcagaggaa 60
           |||||||||||  |||||||||||||||| |  || ||  |||||||||| ||  |||||
Sbjct: 52  atggagagttatttgaatgagaatttcggaggagtcaaatccaagaactcctctcaggaa 111

                                                                       
Query: 61  gcgcttcagcgatggaggaagctctgttggcttgttaagaatcgcaagaggaggtttcgt 120
           || |||||| |||||||||| |||||| || |||| || || | ||| ||| | ||||||
Sbjct: 112 gcacttcagagatggaggaatctctgtggggttgtgaaaaaccccaaaaggcgatttcgt 171

                          
Query: 121 ttcactgctaatctc 135
           |||||||| ||||||
Sbjct: 172 ttcactgcaaatctc 186