Miyakogusa Predicted Gene
- Lj1g3v1548820.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj1g3v1548820.1 tr|G7I7M2|G7I7M2_MEDTR CBL-interacting protein
kinase OS=Medicago truncatula GN=MTR_1g013700 PE=4
SV,42.37,0.004,seg,NULL; NAF,NAF/FISL domain,CUFF.27490.1
(370 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|FS334602 96 2e-19
gnl|LJGI|TC74196 74 7e-13
>gnl|LJGI|FS334602
Length = 694
Score = 95.6 bits (48), Expect = 2e-19
Identities = 72/80 (90%)
Strand = Plus / Minus
Query: 115 tcctcaccaattctagatcctgatgaatctaattccaatcccgattttgaattatcatct 174
|||||||||||| |||||| |||||| || ||||||||||| ||||||||||||||||||
Sbjct: 481 tcctcaccaattgtagatcttgatgactccaattccaatcctgattttgaattatcatct 422
Query: 175 caaaatcatacaacaacaga 194
||||| || ||| |||||||
Sbjct: 421 caaaaccagacagcaacaga 402
>gnl|LJGI|TC74196
Length = 959
Score = 73.8 bits (37), Expect = 7e-13
Identities = 55/61 (90%)
Strand = Plus / Plus
Query: 185 caacaacagatttaggagacaaaaaggcaggaacaaccaaggtcgatgtcttcaatgcgg 244
|||||||||||| ||||||| | ||||||||||||||| ||||||||||||| ||||||
Sbjct: 812 caacaacagattcaggagacgacaaggcaggaacaacccaggtcgatgtctttgatgcgg 871
Query: 245 c 245
|
Sbjct: 872 c 872
Score = 71.9 bits (36), Expect = 3e-12
Identities = 52/56 (92%), Gaps = 1/56 (1%)
Strand = Plus / Plus
Query: 297 tgggttcgatctattgggattgttcaggagaagaggaag-gggagggtttcagtgt 351
||||||||||||||||| ||| ||||||||||||||| | ||||||||||||||||
Sbjct: 889 tgggttcgatctattggaattattcaggagaagaggaggagggagggtttcagtgt 944