Miyakogusa Predicted Gene

Lj1g3v1498450.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj1g3v1498450.1 CUFF.27405.1
         (300 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC67406                                                       94   6e-19
gnl|LJGI|AV779795 similar to UniRef100_Q6ZCX6 Cluster: Circumspo...    64   5e-10
gnl|LJGI|TC66929 similar to UniRef100_A8HYV0 Cluster: Predicted ...    64   5e-10

>gnl|LJGI|TC67406 
          Length = 637

 Score = 93.7 bits (47), Expect = 6e-19
 Identities = 68/75 (90%)
 Strand = Plus / Minus

                                                                       
Query: 58  ccatcaccatcaagccctcttaatcaccatcctctttctctacccttcgatttccctctc 117
           ||||||||||| ||||| ||||||||||| ||| ||||||| ||||||||| ||||||||
Sbjct: 328 ccatcaccatcgagcccccttaatcaccaccctttttctctgcccttcgatctccctctc 269

                          
Query: 118 ggttgtctcgcaatt 132
           | |||||||||||||
Sbjct: 268 gattgtctcgcaatt 254


>gnl|LJGI|AV779795 similar to UniRef100_Q6ZCX6 Cluster: Circumsporozoite protein-like;
           n=1; Oryza sativa Japonica Group|Rep: Circumsporozoite
           protein-like - Oryza sativa subsp. japonica (Rice),
           partial (10%)
          Length = 597

 Score = 63.9 bits (32), Expect = 5e-10
 Identities = 47/52 (90%)
 Strand = Plus / Minus

                                                               
Query: 58  ccatcaccatcaagccctcttaatcaccatcctctttctctacccttcgatt 109
           ||||||||||| ||||| ||||| ||||||||||||||||  ||||||||||
Sbjct: 327 ccatcaccatcgagcccccttaaacaccatcctctttctccgcccttcgatt 276


>gnl|LJGI|TC66929 similar to UniRef100_A8HYV0 Cluster: Predicted protein; n=1;
           Chlamydomonas reinhardtii|Rep: Predicted protein -
           Chlamydomonas reinhardtii, partial (5%)
          Length = 591

 Score = 63.9 bits (32), Expect = 5e-10
 Identities = 47/52 (90%)
 Strand = Plus / Plus

                                                               
Query: 58  ccatcaccatcaagccctcttaatcaccatcctctttctctacccttcgatt 109
           ||||||||||| ||||| ||||| ||||||||||||||||  ||||||||||
Sbjct: 157 ccatcaccatcgagcccccttaaacaccatcctctttctccgcccttcgatt 208