Miyakogusa Predicted Gene
- Lj1g3v1497420.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj1g3v1497420.1 Non Chatacterized Hit- tr|F2R0S4|F2R0S4_STRVP
Uncharacterized protein OS=Streptomyces venezuelae (st,27.78,0.038,
,CUFF.27403.1
(336 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC64190 84 6e-16
gnl|LJGI|FS321858 UniRef100_Q8N773 Cluster: CDNA FLJ25969 fis c... 72 2e-12
>gnl|LJGI|TC64190
Length = 1108
Score = 83.8 bits (42), Expect = 6e-16
Identities = 57/61 (93%), Gaps = 2/61 (3%)
Strand = Plus / Plus
Query: 232 tgtcccgtcatgtatgacgttataagtggcgatgaggaggtgtgtcctatcattgtcccg 291
||||||||| ||| ||||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 288 tgtcccgtcttgtgtgacg--ataagtggcgatgaggaggtgtgtcctatcattgtcccg 345
Query: 292 t 292
|
Sbjct: 346 t 346
Score = 61.9 bits (31), Expect = 2e-09
Identities = 37/39 (94%)
Strand = Plus / Plus
Query: 254 taagtggcgatgaggaggtgtgtcctatcattgtcccgt 292
||||||||||| |||||||||||||||| ||||||||||
Sbjct: 257 taagtggcgatcaggaggtgtgtcctatgattgtcccgt 295
Score = 50.1 bits (25), Expect = 9e-06
Identities = 25/25 (100%)
Strand = Plus / Plus
Query: 266 aggaggtgtgtcctatcattgtccc 290
|||||||||||||||||||||||||
Sbjct: 216 aggaggtgtgtcctatcattgtccc 240
>gnl|LJGI|FS321858 UniRef100_Q8N773 Cluster: CDNA FLJ25969 fis clone CBR02250; n=1;
Homo sapiens|Rep: CDNA FLJ25969 fis clone, partial (6%)
Length = 771
Score = 71.9 bits (36), Expect = 2e-12
Identities = 36/36 (100%)
Strand = Plus / Plus
Query: 255 aagtggcgatgaggaggtgtgtcctatcattgtccc 290
||||||||||||||||||||||||||||||||||||
Sbjct: 631 aagtggcgatgaggaggtgtgtcctatcattgtccc 666
Score = 58.0 bits (29), Expect = 4e-08
Identities = 35/37 (94%)
Strand = Plus / Plus
Query: 254 taagtggcgatgaggaggtgtgtcctatcattgtccc 290
||||||||||| |||||||||||||||| ||||||||
Sbjct: 681 taagtggcgatcaggaggtgtgtcctatgattgtccc 717
Score = 54.0 bits (27), Expect = 6e-07
Identities = 36/39 (92%)
Strand = Plus / Plus
Query: 254 taagtggcgatgaggaggtgtgtcctatcattgtcccgt 292
||||||||||| ||||||||||| |||| ||||||||||
Sbjct: 732 taagtggcgatcaggaggtgtgttctatgattgtcccgt 770