Miyakogusa Predicted Gene

Lj1g3v1454010.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj1g3v1454010.1 tr|E5GBL8|E5GBL8_CUCME ATP-dependent clp protease
OS=Cucumis melo subsp. melo PE=3 SV=1,92.31,8e-19,seg,NULL; no
description,NULL,NODE_36035_length_440_cov_1652.984131.path1.1
         (160 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC69392 homologue to UniRef100_P35100 Cluster: ATP-depe...   317   1e-86
gnl|LJGI|TC67742 homologue to UniRef100_P35100 Cluster: ATP-depe...   176   3e-44
gnl|LJGI|TC68946 homologue to UniRef100_P35100 Cluster: ATP-depe...   133   3e-31
gnl|LJGI|BP056126 similar to UniRef100_P35100 Cluster: ATP-depen...   107   2e-23
gnl|LJGI|AV778863 similar to UniRef100_P35100 Cluster: ATP-depen...    94   3e-19

>gnl|LJGI|TC69392 homologue to UniRef100_P35100 Cluster: ATP-dependent Clp protease
           ATP-binding subunit clpC homolog, chloroplast precursor;
           n=1; Pisum sativum|Rep: ATP-dependent Clp protease
           ATP-binding subunit clpC homolog, chloroplast precursor
           - Pisum sativum (Garden pea), partial (13%)
          Length = 704

 Score =  317 bits (160), Expect = 1e-86
 Identities = 160/160 (100%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgcgactcttggaggacagcatggctgagaagatgcttgctagagagatcaaagagggc 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 217 atgcgactcttggaggacagcatggctgagaagatgcttgctagagagatcaaagagggc 276

                                                                       
Query: 61  gactctgtcatagtggacgttgattctgacggtaatgtgatcgtgctcaatggtagcagt 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 277 gactctgtcatagtggacgttgattctgacggtaatgtgatcgtgctcaatggtagcagt 336

                                                   
Query: 121 ggcaccccggagtcgttaccagaggctcttcctgtataaa 160
           ||||||||||||||||||||||||||||||||||||||||
Sbjct: 337 ggcaccccggagtcgttaccagaggctcttcctgtataaa 376


>gnl|LJGI|TC67742 homologue to UniRef100_P35100 Cluster: ATP-dependent Clp protease
           ATP-binding subunit clpC homolog, chloroplast precursor;
           n=1; Pisum sativum|Rep: ATP-dependent Clp protease
           ATP-binding subunit clpC homolog, chloroplast precursor
           - Pisum sativum (Garden pea), partial (15%)
          Length = 764

 Score =  176 bits (89), Expect = 3e-44
 Identities = 113/121 (93%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgcgactcttggaggacagcatggctgagaagatgcttgctagagagatcaaagagggc 60
           |||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 259 atgcgactcttggaggacagcatggcagagaagatgcttgctagagagattaaagagggc 318

                                                                       
Query: 61  gactctgtcatagtggacgttgattctgacggtaatgtgatcgtgctcaatggtagcagt 120
           |||||||| ||||| || | ||||||||| ||||||||||| ||||||||||||||||||
Sbjct: 319 gactctgttatagttgatgctgattctgatggtaatgtgattgtgctcaatggtagcagt 378

            
Query: 121 g 121
           |
Sbjct: 379 g 379


>gnl|LJGI|TC68946 homologue to UniRef100_P35100 Cluster: ATP-dependent Clp protease
            ATP-binding subunit clpC homolog, chloroplast precursor;
            n=1; Pisum sativum|Rep: ATP-dependent Clp protease
            ATP-binding subunit clpC homolog, chloroplast precursor -
            Pisum sativum (Garden pea), partial (55%)
          Length = 1752

 Score =  133 bits (67), Expect = 3e-31
 Identities = 133/155 (85%)
 Strand = Plus / Plus

                                                                        
Query: 1    atgcgactcttggaggacagcatggctgagaagatgcttgctagagagatcaaagagggc 60
            ||||| |||||||||||||||||||| ||||||||||||||| ||||||| |||||||| 
Sbjct: 1375 atgcggctcttggaggacagcatggcagagaagatgcttgctggagagattaaagagggt 1434

                                                                        
Query: 61   gactctgtcatagtggacgttgattctgacggtaatgtgatcgtgctcaatggtagcagt 120
            |||||||| ||| | || | ||||||||| ||||| ||||| |||||||||||||| |||
Sbjct: 1435 gactctgttataattgatgctgattctgatggtaaggtgattgtgctcaatggtagtagt 1494

                                               
Query: 121  ggcaccccggagtcgttaccagaggctcttcctgt 155
            ||  | || || ||  | |||||||||||||||||
Sbjct: 1495 ggtgcaccagaatcactgccagaggctcttcctgt 1529


>gnl|LJGI|BP056126 similar to UniRef100_P35100 Cluster: ATP-dependent Clp protease
           ATP-binding subunit clpC homolog, chloroplast precursor;
           n=1; Pisum sativum|Rep: ATP-dependent Clp protease
           ATP-binding subunit clpC homolog, chloroplast precursor
           - Pisum sativum (Garden pea), partial (7%)
          Length = 462

 Score =  107 bits (54), Expect = 2e-23
 Identities = 105/122 (86%)
 Strand = Plus / Minus

                                                                       
Query: 1   atgcgactcttggaggacagcatggctgagaagatgcttgctagagagatcaaagagggc 60
           ||||| |||||||||||| || |||| ||||||||||||||| ||||||| |||||||| 
Sbjct: 405 atgcggctcttggaggaccgcctggccgagaagatgcttgctggagagattaaagagggt 346

                                                                       
Query: 61  gactctgtcatagtggacgttgattctgacggtaatgtgatcgtgctcaatggtagcagt 120
           |||||||| ||| | || | ||||||||| ||||| ||||| |||||| ||||||| |||
Sbjct: 345 gactctgttataattgatgctgattctgatggtaaggtgattgtgctccatggtagtagt 286

             
Query: 121 gg 122
           ||
Sbjct: 285 gg 284


>gnl|LJGI|AV778863 similar to UniRef100_P35100 Cluster: ATP-dependent Clp protease
           ATP-binding subunit clpC homolog, chloroplast precursor;
           n=1; Pisum sativum|Rep: ATP-dependent Clp protease
           ATP-binding subunit clpC homolog, chloroplast precursor
           - Pisum sativum (Garden pea), partial (4%)
          Length = 441

 Score = 93.7 bits (47), Expect = 3e-19
 Identities = 96/111 (86%), Gaps = 1/111 (0%)
 Strand = Plus / Minus

                                                                       
Query: 7   ctcttggaggacagcatggctgagaagatgcttgctagagagatcaaagagggcgactct 66
           |||||||||||||||||| | ||||| || ||| |||||||||| |||||||||||||||
Sbjct: 441 ctcttggaggacagcatgcccgagaa-atactttctagagagattaaagagggcgactct 383

                                                              
Query: 67  gtcatagtggacgttgattctgacggtaatgtgatcgtgctcaatggtagc 117
            | ||||| || | ||||||||| ||||| ||||| |||||| ||||||||
Sbjct: 382 cttatagttgatgctgattctgatggtaaagtgattgtgctccatggtagc 332