Miyakogusa Predicted Gene

Lj1g3v1318150.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj1g3v1318150.1 Non Chatacterized Hit- tr|I1BZ92|I1BZ92_RHIO9
Uncharacterized protein OS=Rhizopus delemar (strain
RA,37.93,2e-17,seg,NULL; no description,Phosphoinositide 3-kinase,
accessory (PIK) domain; ARM
repeat,Armadillo-typ,NODE_57591_length_789_cov_99.144485.path1.1
         (781 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|FS359897 similar to UniRef100_Q9ZPE1 Cluster: Phosphati...    68   9e-11

>gnl|LJGI|FS359897 similar to UniRef100_Q9ZPE1 Cluster: Phosphatidylinositol 4-kinase;
           n=1; Arabidopsis thaliana|Rep: Phosphatidylinositol
           4-kinase - Arabidopsis thaliana (Mouse-ear cress),
           partial (12%)
          Length = 834

 Score = 67.9 bits (34), Expect = 9e-11
 Identities = 34/34 (100%)
 Strand = Plus / Minus

                                             
Query: 748 gatagcaaaggtgacgaagagctggggcaaaaaa 781
           ||||||||||||||||||||||||||||||||||
Sbjct: 834 gatagcaaaggtgacgaagagctggggcaaaaaa 801