Miyakogusa Predicted Gene
- Lj1g3v1300590.3
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj1g3v1300590.3 Non Chatacterized Hit- tr|F6H4A0|F6H4A0_VITVI
Putative uncharacterized protein OS=Vitis vinifera
GN=,41.25,0.000000000000005,seg,NULL,CUFF.27087.3
(517 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC63828 similar to UniRef100_Q9LV84 Cluster: ABC transp... 80 2e-14
>gnl|LJGI|TC63828 similar to UniRef100_Q9LV84 Cluster: ABC transporter-like; n=1;
Arabidopsis thaliana|Rep: ABC transporter-like -
Arabidopsis thaliana (Mouse-ear cress), partial (10%)
Length = 727
Score = 79.8 bits (40), Expect = 2e-14
Identities = 46/48 (95%)
Strand = Plus / Plus
Query: 363 gaggaagaggaggttggaggagattggcaaagaagatgcgtggtttaa 410
||||||||||||||||||||||||||| ||||| ||||||||||||||
Sbjct: 427 gaggaagaggaggttggaggagattgggaaagaggatgcgtggtttaa 474