Miyakogusa Predicted Gene

Lj1g3v1300590.3
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj1g3v1300590.3 Non Chatacterized Hit- tr|F6H4A0|F6H4A0_VITVI
Putative uncharacterized protein OS=Vitis vinifera
GN=,41.25,0.000000000000005,seg,NULL,CUFF.27087.3
         (517 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC63828 similar to UniRef100_Q9LV84 Cluster: ABC transp...    80   2e-14

>gnl|LJGI|TC63828 similar to UniRef100_Q9LV84 Cluster: ABC transporter-like; n=1;
           Arabidopsis thaliana|Rep: ABC transporter-like -
           Arabidopsis thaliana (Mouse-ear cress), partial (10%)
          Length = 727

 Score = 79.8 bits (40), Expect = 2e-14
 Identities = 46/48 (95%)
 Strand = Plus / Plus

                                                           
Query: 363 gaggaagaggaggttggaggagattggcaaagaagatgcgtggtttaa 410
           ||||||||||||||||||||||||||| ||||| ||||||||||||||
Sbjct: 427 gaggaagaggaggttggaggagattgggaaagaggatgcgtggtttaa 474