Miyakogusa Predicted Gene

Lj1g3v1255850.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj1g3v1255850.1 Non Chatacterized Hit- tr|I1LAP7|I1LAP7_SOYBN
Uncharacterized protein (Fragment) OS=Glycine max
PE=4,74.36,0.000000003,coiled-coil,NULL; SUBFAMILY NOT NAMED,NULL;
MYB-LIKE DNA-BINDING PROTEIN MYB,NULL; Homeodomain-like,,CUFF.27043.1
         (786 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC79087 homologue to UniRef100_Q0PJJ6 Cluster: MYB tran...    70   2e-11
gnl|LJGI|TC76156 homologue to UniRef100_Q43525 Cluster: Transcri...    66   4e-10
gnl|LJGI|TC58575 similar to UniRef100_A7QY25 Cluster: Chromosome...    60   2e-08
gnl|LJGI|TC82622 UniRef100_Q84PP5 Cluster: Transcription factor ...    56   3e-07
gnl|LJGI|GO032081 homologue to UniRef100_Q09GS2 Cluster: Transcr...    54   1e-06
gnl|LJGI|TC70299 homologue to UniRef100_Q7X9I1 Cluster: MYB tran...    54   1e-06
gnl|LJGI|TC62351 similar to UniRef100_Q0PJJ9 Cluster: MYB transc...    52   5e-06

>gnl|LJGI|TC79087 homologue to UniRef100_Q0PJJ6 Cluster: MYB transcription factor
           MYB181; n=1; Glycine max|Rep: MYB transcription factor
           MYB181 - Glycine max (Soybean), partial (69%)
          Length = 532

 Score = 69.9 bits (35), Expect = 2e-11
 Identities = 70/79 (88%), Gaps = 2/79 (2%)
 Strand = Plus / Plus

                                                                       
Query: 276 atggggaaacaggtggtcaacaattgcaaga-agcttgccagggagaactgacaatgaga 334
           |||||||||||||||||| | |||||| | | | ||| ||||||||||||||||||||||
Sbjct: 323 atggggaaacaggtggtccaaaattgccaaacatctt-ccagggagaactgacaatgaga 381

                              
Query: 335 taaagaattactggaggac 353
           ||||||| | |||||||||
Sbjct: 382 taaagaacttctggaggac 400


>gnl|LJGI|TC76156 homologue to UniRef100_Q43525 Cluster: Transcription factor; n=1;
           Solanum lycopersicum|Rep: Transcription factor - Solanum
           lycopersicum (Tomato) (Lycopersicon esculentum), partial
           (61%)
          Length = 1383

 Score = 65.9 bits (33), Expect = 4e-10
 Identities = 42/45 (93%)
 Strand = Plus / Plus

                                                        
Query: 305 gaagcttgccagggagaactgacaatgagataaagaattactgga 349
           |||| |||||||| ||||| |||||||||||||||||||||||||
Sbjct: 554 gaagattgccaggaagaacagacaatgagataaagaattactgga 598


>gnl|LJGI|TC58575 similar to UniRef100_A7QY25 Cluster: Chromosome undetermined
           scaffold_237, whole genome shotgun sequence; n=1; Vitis
           vinifera|Rep: Chromosome undetermined scaffold_237,
           whole genome shotgun sequence - Vitis vinifera (Grape),
           partial (63%)
          Length = 799

 Score = 60.0 bits (30), Expect = 2e-08
 Identities = 39/42 (92%)
 Strand = Plus / Plus

                                                     
Query: 171 tgggaagagttgcagattgagatgggtgaattatctgagacc 212
           ||||||||||||||||||||||||| |||| || ||||||||
Sbjct: 182 tgggaagagttgcagattgagatggttgaactacctgagacc 223


>gnl|LJGI|TC82622 UniRef100_Q84PP5 Cluster: Transcription factor MYB101; n=1; Lotus
           japonicus|Rep: Transcription factor MYB101 - Lotus
           japonicus, partial (98%)
          Length = 1068

 Score = 56.0 bits (28), Expect = 3e-07
 Identities = 52/60 (86%)
 Strand = Plus / Plus

                                                                       
Query: 310 ttgccagggagaactgacaatgagataaagaattactggaggacccatttcaagaaaaag 369
           ||||||||||| ||||| ||||| || ||||||| |||||  |||||||| |||||||||
Sbjct: 307 ttgccagggaggactgataatgaaatcaagaatttctggaacacccatttgaagaaaaag 366


>gnl|LJGI|GO032081 homologue to UniRef100_Q09GS2 Cluster: Transcription factor MYBJ7;
           n=1; Glycine max|Rep: Transcription factor MYBJ7 -
           Glycine max (Soybean), partial (51%)
          Length = 653

 Score = 54.0 bits (27), Expect = 1e-06
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                  
Query: 311 tgccagggagaactgacaatgagataaagaattactgga 349
           |||||||||| ||||||||||| |||||||| |||||||
Sbjct: 493 tgccagggaggactgacaatgatataaagaactactgga 531


>gnl|LJGI|TC70299 homologue to UniRef100_Q7X9I1 Cluster: MYB transcription factor
           R2R3 type; n=1; Populus tremula x Populus
           tremuloides|Rep: MYB transcription factor R2R3 type -
           Populus tremula x Populus tremuloides, partial (64%)
          Length = 1028

 Score = 54.0 bits (27), Expect = 1e-06
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 319 agaactgacaatgagataaagaattactgga 349
           ||||| |||||||||||||||||||||||||
Sbjct: 429 agaacagacaatgagataaagaattactgga 459


>gnl|LJGI|TC62351 similar to UniRef100_Q0PJJ9 Cluster: MYB transcription factor
           MYB92; n=2; Glycine max|Rep: MYB transcription factor
           MYB92 - Glycine max (Soybean), partial (60%)
          Length = 1128

 Score = 52.0 bits (26), Expect = 5e-06
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 175 aagagttgcagattgagatgggtgaattatctgagaccagac 216
           |||||||||||| | |||||| |||| |||||||||||||||
Sbjct: 241 aagagttgcagactaagatggatgaactatctgagaccagac 282