Miyakogusa Predicted Gene
- Lj1g3v1255850.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj1g3v1255850.1 Non Chatacterized Hit- tr|I1LAP7|I1LAP7_SOYBN
Uncharacterized protein (Fragment) OS=Glycine max
PE=4,74.36,0.000000003,coiled-coil,NULL; SUBFAMILY NOT NAMED,NULL;
MYB-LIKE DNA-BINDING PROTEIN MYB,NULL; Homeodomain-like,,CUFF.27043.1
(786 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC79087 homologue to UniRef100_Q0PJJ6 Cluster: MYB tran... 70 2e-11
gnl|LJGI|TC76156 homologue to UniRef100_Q43525 Cluster: Transcri... 66 4e-10
gnl|LJGI|TC58575 similar to UniRef100_A7QY25 Cluster: Chromosome... 60 2e-08
gnl|LJGI|TC82622 UniRef100_Q84PP5 Cluster: Transcription factor ... 56 3e-07
gnl|LJGI|GO032081 homologue to UniRef100_Q09GS2 Cluster: Transcr... 54 1e-06
gnl|LJGI|TC70299 homologue to UniRef100_Q7X9I1 Cluster: MYB tran... 54 1e-06
gnl|LJGI|TC62351 similar to UniRef100_Q0PJJ9 Cluster: MYB transc... 52 5e-06
>gnl|LJGI|TC79087 homologue to UniRef100_Q0PJJ6 Cluster: MYB transcription factor
MYB181; n=1; Glycine max|Rep: MYB transcription factor
MYB181 - Glycine max (Soybean), partial (69%)
Length = 532
Score = 69.9 bits (35), Expect = 2e-11
Identities = 70/79 (88%), Gaps = 2/79 (2%)
Strand = Plus / Plus
Query: 276 atggggaaacaggtggtcaacaattgcaaga-agcttgccagggagaactgacaatgaga 334
|||||||||||||||||| | |||||| | | | ||| ||||||||||||||||||||||
Sbjct: 323 atggggaaacaggtggtccaaaattgccaaacatctt-ccagggagaactgacaatgaga 381
Query: 335 taaagaattactggaggac 353
||||||| | |||||||||
Sbjct: 382 taaagaacttctggaggac 400
>gnl|LJGI|TC76156 homologue to UniRef100_Q43525 Cluster: Transcription factor; n=1;
Solanum lycopersicum|Rep: Transcription factor - Solanum
lycopersicum (Tomato) (Lycopersicon esculentum), partial
(61%)
Length = 1383
Score = 65.9 bits (33), Expect = 4e-10
Identities = 42/45 (93%)
Strand = Plus / Plus
Query: 305 gaagcttgccagggagaactgacaatgagataaagaattactgga 349
|||| |||||||| ||||| |||||||||||||||||||||||||
Sbjct: 554 gaagattgccaggaagaacagacaatgagataaagaattactgga 598
>gnl|LJGI|TC58575 similar to UniRef100_A7QY25 Cluster: Chromosome undetermined
scaffold_237, whole genome shotgun sequence; n=1; Vitis
vinifera|Rep: Chromosome undetermined scaffold_237,
whole genome shotgun sequence - Vitis vinifera (Grape),
partial (63%)
Length = 799
Score = 60.0 bits (30), Expect = 2e-08
Identities = 39/42 (92%)
Strand = Plus / Plus
Query: 171 tgggaagagttgcagattgagatgggtgaattatctgagacc 212
||||||||||||||||||||||||| |||| || ||||||||
Sbjct: 182 tgggaagagttgcagattgagatggttgaactacctgagacc 223
>gnl|LJGI|TC82622 UniRef100_Q84PP5 Cluster: Transcription factor MYB101; n=1; Lotus
japonicus|Rep: Transcription factor MYB101 - Lotus
japonicus, partial (98%)
Length = 1068
Score = 56.0 bits (28), Expect = 3e-07
Identities = 52/60 (86%)
Strand = Plus / Plus
Query: 310 ttgccagggagaactgacaatgagataaagaattactggaggacccatttcaagaaaaag 369
||||||||||| ||||| ||||| || ||||||| ||||| |||||||| |||||||||
Sbjct: 307 ttgccagggaggactgataatgaaatcaagaatttctggaacacccatttgaagaaaaag 366
>gnl|LJGI|GO032081 homologue to UniRef100_Q09GS2 Cluster: Transcription factor MYBJ7;
n=1; Glycine max|Rep: Transcription factor MYBJ7 -
Glycine max (Soybean), partial (51%)
Length = 653
Score = 54.0 bits (27), Expect = 1e-06
Identities = 36/39 (92%)
Strand = Plus / Plus
Query: 311 tgccagggagaactgacaatgagataaagaattactgga 349
|||||||||| ||||||||||| |||||||| |||||||
Sbjct: 493 tgccagggaggactgacaatgatataaagaactactgga 531
>gnl|LJGI|TC70299 homologue to UniRef100_Q7X9I1 Cluster: MYB transcription factor
R2R3 type; n=1; Populus tremula x Populus
tremuloides|Rep: MYB transcription factor R2R3 type -
Populus tremula x Populus tremuloides, partial (64%)
Length = 1028
Score = 54.0 bits (27), Expect = 1e-06
Identities = 30/31 (96%)
Strand = Plus / Plus
Query: 319 agaactgacaatgagataaagaattactgga 349
||||| |||||||||||||||||||||||||
Sbjct: 429 agaacagacaatgagataaagaattactgga 459
>gnl|LJGI|TC62351 similar to UniRef100_Q0PJJ9 Cluster: MYB transcription factor
MYB92; n=2; Glycine max|Rep: MYB transcription factor
MYB92 - Glycine max (Soybean), partial (60%)
Length = 1128
Score = 52.0 bits (26), Expect = 5e-06
Identities = 38/42 (90%)
Strand = Plus / Plus
Query: 175 aagagttgcagattgagatgggtgaattatctgagaccagac 216
|||||||||||| | |||||| |||| |||||||||||||||
Sbjct: 241 aagagttgcagactaagatggatgaactatctgagaccagac 282