Miyakogusa Predicted Gene

Lj1g3v1181870.1

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj1g3v1181870.1 CUFF.26908.1
         (328 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC78593 similar to UniRef100_A9B1K8 Cluster: Binding-pr...   180   4e-45

>gnl|LJGI|TC78593 similar to UniRef100_A9B1K8 Cluster: Binding-protein-dependent
           transport systems inner membrane component precursor;
           n=1; Herpetosiphon aurantiacus ATCC 23779|Rep:
           Binding-protein-dependent transport systems inner
           membrane component precursor - Herpetosiphon aurantiacus
           ATCC 23779, partial (6%)
          Length = 970

 Score =  180 bits (91), Expect = 4e-45
 Identities = 130/143 (90%)
 Strand = Plus / Plus

                                                                       
Query: 34  cagatcctctgtttttcacttcttctgttcgatccgcttgttgtgcttgctactcactgg 93
           ||||||||||||| ||||||||| ||||| || |||||||||||||||||| ||| ||||
Sbjct: 778 cagatcctctgttcttcacttctgctgtttgaaccgcttgttgtgcttgcttctcgctgg 837

                                                                       
Query: 94  aaaacgccaccgcagatgccaccacggtcgccggaaacggccgtcgcagggagggtggaa 153
           |||||||||||||||| ||| ||| ||||||||||||| |||||||||||| ||||||| 
Sbjct: 838 aaaacgccaccgcagaggcctccatggtcgccggaaaccgccgtcgcagggtgggtggag 897

                                  
Query: 154 gccggcgctcaaggcaagggttt 176
           | |||||||||||||||||||||
Sbjct: 898 gtcggcgctcaaggcaagggttt 920



 Score =  123 bits (62), Expect = 7e-28
 Identities = 102/114 (89%), Gaps = 1/114 (0%)
 Strand = Plus / Plus

                                                                       
Query: 74  ttgtgcttgctactcactggaaaacgccaccgcagatgccaccacggtcgccggaaacgg 133
           ||||||||||| ||| |||||||||||| ||||||| |||||||||||||| |||||| |
Sbjct: 670 ttgtgcttgctgctcgctggaaaacgccgccgcagaggccaccacggtcgctggaaaccg 729

                                                                 
Query: 134 ccgtcgcagggagggtggaagccggcgctcaaggcaagggtttctgttgcagat 187
           |||| ||| ||||||||||||||||||||| ||| || ||| ||||||||||||
Sbjct: 730 ccgttgca-ggagggtggaagccggcgctcgaggtaatggtatctgttgcagat 782