Miyakogusa Predicted Gene

Lj1g3v1147600.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj1g3v1147600.1 Non Chatacterized Hit- tr|B9R7I8|B9R7I8_RICCO
Protein Z, putative OS=Ricinus communis
GN=RCOM_159199,60.45,0,seg,NULL; SERine  Proteinase INhibitors,Serpin
domain; Serpin,Serpin domain; no description,NULL; SE,gene.g30908.t1.1
         (845 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|DN652263 similar to UniRef100_Q8GT65 Cluster: Serpin-li...    76   4e-13
gnl|LJGI|TC72280 weakly similar to UniRef100_Q8GT65 Cluster: Ser...    70   2e-11
gnl|LJGI|TC75793 similar to UniRef100_Q2HSM8 Cluster: Proteinase...    64   2e-09
gnl|LJGI|TC59164 weakly similar to UniRef100_Q2HSM8 Cluster: Pro...    62   6e-09
gnl|LJGI|TC77786 similar to UniRef100_Q8GT65 Cluster: Serpin-lik...    58   9e-08
gnl|LJGI|TC63990 similar to UniRef100_Q8GT65 Cluster: Serpin-lik...    58   9e-08
gnl|LJGI|TC67954 similar to UniRef100_Q8GT65 Cluster: Serpin-lik...    52   6e-06

>gnl|LJGI|DN652263 similar to UniRef100_Q8GT65 Cluster: Serpin-like protein; n=1;
           Citrus x paradisi|Rep: Serpin-like protein - Citrus
           paradisi (Grapefruit), partial (10%)
          Length = 125

 Score = 75.8 bits (38), Expect = 4e-13
 Identities = 47/50 (94%)
 Strand = Plus / Plus

                                                             
Query: 349 ttctctatgtatattttccttccggatgcaaatgatgggctgccagcttt 398
           ||||||||||| ||||||||||||||||| || |||||||||||||||||
Sbjct: 75  ttctctatgtacattttccttccggatgccaaagatgggctgccagcttt 124


>gnl|LJGI|TC72280 weakly similar to UniRef100_Q8GT65 Cluster: Serpin-like protein;
           n=1; Citrus x paradisi|Rep: Serpin-like protein - Citrus
           paradisi (Grapefruit), partial (58%)
          Length = 827

 Score = 69.9 bits (35), Expect = 2e-11
 Identities = 175/222 (78%), Gaps = 6/222 (2%)
 Strand = Plus / Plus

                                                                       
Query: 40  gaagtggtcaatgaagttaatttgtgggctgaagaaaagacaaaggggcttatcaaagac 99
           ||||||| |||||||||||||   ||||||||  || ||||||| || ||| ||||||| 
Sbjct: 458 gaagtggccaatgaagttaatgcatgggctgagaaagagacaaatggtcttgtcaaagat 517

                                                                       
Query: 100 attcttccttctggttcacttggcagcttcacaaggctcatttttgcaaattcactgtac 159
            |||||||| |||| ||| |||    ||  || |||||||| ||||||||| || |||| 
Sbjct: 518 cttcttcctgctgggtcagttgatgcctcaaccaggctcatctttgcaaatgcattgtat 577

                                                                       
Query: 160 ttcaaagctgcatggcaagagagagacaagtttaatgcatcaatgacaaaagagggtgat 219
           ||||||| |||||||   ||||      ||||| |||| |||||||| |||||  |||||
Sbjct: 578 ttcaaaggtgcatggactgaga------agtttgatgcttcaatgactaaagactgtgat 631

                                                     
Query: 220 tttcacattctgaatggcacatcagttaaggttccgttcatg 261
           |||||| ||||  ||||||| ||||| |||||||| ||||||
Sbjct: 632 tttcaccttcttgatggcacctcagtcaaggttcccttcatg 673


>gnl|LJGI|TC75793 similar to UniRef100_Q2HSM8 Cluster: Proteinase inhibitor I4,
           serpin; n=1; Medicago truncatula|Rep: Proteinase
           inhibitor I4, serpin - Medicago truncatula (Barrel
           medic), partial (35%)
          Length = 722

 Score = 63.9 bits (32), Expect = 2e-09
 Identities = 68/80 (85%)
 Strand = Plus / Plus

                                                                       
Query: 754 gtagctgaccaccctttcttgttccttattagagaaagtttgtctggaactgtgttcttt 813
           ||||||||||| |||||| ||||||| || ||||||  ||||||||||||  |  | |||
Sbjct: 422 gtagctgaccatcctttcatgttcctgatcagagaagatttgtctggaacaatactattt 481

                               
Query: 814 attggacaggtgctcaatcc 833
           ||||| ||||||||||||||
Sbjct: 482 attgggcaggtgctcaatcc 501



 Score = 56.0 bits (28), Expect = 4e-07
 Identities = 121/152 (79%)
 Strand = Plus / Plus

                                                                       
Query: 349 ttctctatgtatattttccttccggatgcaaatgatgggctgccagctttggttgagcga 408
           ||||| ||||| ||||| |||||  |||||||  |||||||| ||| |||||| ||||  
Sbjct: 32  ttctccatgtacatttttcttccacatgcaaaaaatgggctgtcagatttggtggagctg 91

                                                                       
Query: 409 gtgacttctgaatctgggttcctagaacatcatcttcctgatagagaagtggaagtacga 468
           ||||||||  ||||||||||||| |||    | |||||| ||    |||| |||||| | 
Sbjct: 92  gtgacttcaaaatctgggttcctcgaaagcaagcttcctaatcataaagttgaagtaggt 151

                                           
Query: 469 gacttcaggattccaaaattcaagttttcttt 500
           |||||||||||||| ||||||||  |||||||
Sbjct: 152 gacttcaggattcccaaattcaaaatttcttt 183


>gnl|LJGI|TC59164 weakly similar to UniRef100_Q2HSM8 Cluster: Proteinase inhibitor
           I4, serpin; n=1; Medicago truncatula|Rep: Proteinase
           inhibitor I4, serpin - Medicago truncatula (Barrel
           medic), partial (40%)
          Length = 819

 Score = 61.9 bits (31), Expect = 6e-09
 Identities = 94/115 (81%)
 Strand = Plus / Plus

                                                                       
Query: 52  gaagttaatttgtgggctgaagaaaagacaaaggggcttatcaaagacattcttccttct 111
           ||||| ||||| ||||||||  || ||||||| || |||||||||||| |||||||| ||
Sbjct: 655 gaagtgaatttatgggctgagaaagagacaaaaggccttatcaaagaccttcttcctcct 714

                                                                  
Query: 112 ggttcacttggcagcttcacaaggctcatttttgcaaattcactgtacttcaaag 166
           || ||| |||||  ||| || || || || |||| |||| || ||||||||||||
Sbjct: 715 gggtcagttggccacttaaccagacttatctttgtaaatgcattgtacttcaaag 769


>gnl|LJGI|TC77786 similar to UniRef100_Q8GT65 Cluster: Serpin-like protein; n=1;
           Citrus x paradisi|Rep: Serpin-like protein - Citrus
           paradisi (Grapefruit), partial (70%)
          Length = 1367

 Score = 58.0 bits (29), Expect = 9e-08
 Identities = 44/49 (89%)
 Strand = Plus / Plus

                                                            
Query: 455 aagtggaagtacgagacttcaggattccaaaattcaagttttctttcgg 503
           ||||||||||| | |||||||||||||| ||||||||  ||||||||||
Sbjct: 800 aagtggaagtaggtgacttcaggattcccaaattcaaaatttctttcgg 848


>gnl|LJGI|TC63990 similar to UniRef100_Q8GT65 Cluster: Serpin-like protein; n=1;
           Citrus x paradisi|Rep: Serpin-like protein - Citrus
           paradisi (Grapefruit), partial (16%)
          Length = 831

 Score = 58.0 bits (29), Expect = 9e-08
 Identities = 74/89 (83%)
 Strand = Plus / Plus

                                                                       
Query: 746 tagattttgtagctgaccaccctttcttgttccttattagagaaagtttgtctggaactg 805
           |||| ||||||||||||||||||||||| ||| | || ||||||  |||  |||||||  
Sbjct: 411 tagactttgtagctgaccaccctttcttcttcttgatcagagaagattttactggaacaa 470

                                        
Query: 806 tgttctttattggacaggtgctcaatcct 834
           |  |||||||||| ||||||||| |||||
Sbjct: 471 ttctctttattgggcaggtgctccatcct 499



 Score = 56.0 bits (28), Expect = 4e-07
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 343 cgccaattctctatgtatattttccttccggatgcaaatgatgggctgccagcttt 398
           |||| |||||| ||||| ||||||||||||||||||||  ||||  ||||||||||
Sbjct: 20  cgccgattctccatgtacattttccttccggatgcaaaaaatggattgccagcttt 75


>gnl|LJGI|TC67954 similar to UniRef100_Q8GT65 Cluster: Serpin-like protein; n=1;
           Citrus x paradisi|Rep: Serpin-like protein - Citrus
           paradisi (Grapefruit), partial (31%)
          Length = 781

 Score = 52.0 bits (26), Expect = 6e-06
 Identities = 74/90 (82%)
 Strand = Plus / Plus

                                                                       
Query: 744 ggtagattttgtagctgaccaccctttcttgttccttattagagaaagtttgtctggaac 803
           ||||||||| |||||||||||||| ||||||||| | || ||||||  |||| | |||||
Sbjct: 330 ggtagatttcgtagctgaccaccccttcttgttcgtgatcagagaagatttgaccggaac 389

                                         
Query: 804 tgtgttctttattggacaggtgctcaatcc 833
            ||  | ||||  || ||||||||||||||
Sbjct: 390 agtactatttacagggcaggtgctcaatcc 419