Miyakogusa Predicted Gene
- Lj1g3v1147600.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj1g3v1147600.1 Non Chatacterized Hit- tr|B9R7I8|B9R7I8_RICCO
Protein Z, putative OS=Ricinus communis
GN=RCOM_159199,60.45,0,seg,NULL; SERine Proteinase INhibitors,Serpin
domain; Serpin,Serpin domain; no description,NULL; SE,gene.g30908.t1.1
(845 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|DN652263 similar to UniRef100_Q8GT65 Cluster: Serpin-li... 76 4e-13
gnl|LJGI|TC72280 weakly similar to UniRef100_Q8GT65 Cluster: Ser... 70 2e-11
gnl|LJGI|TC75793 similar to UniRef100_Q2HSM8 Cluster: Proteinase... 64 2e-09
gnl|LJGI|TC59164 weakly similar to UniRef100_Q2HSM8 Cluster: Pro... 62 6e-09
gnl|LJGI|TC77786 similar to UniRef100_Q8GT65 Cluster: Serpin-lik... 58 9e-08
gnl|LJGI|TC63990 similar to UniRef100_Q8GT65 Cluster: Serpin-lik... 58 9e-08
gnl|LJGI|TC67954 similar to UniRef100_Q8GT65 Cluster: Serpin-lik... 52 6e-06
>gnl|LJGI|DN652263 similar to UniRef100_Q8GT65 Cluster: Serpin-like protein; n=1;
Citrus x paradisi|Rep: Serpin-like protein - Citrus
paradisi (Grapefruit), partial (10%)
Length = 125
Score = 75.8 bits (38), Expect = 4e-13
Identities = 47/50 (94%)
Strand = Plus / Plus
Query: 349 ttctctatgtatattttccttccggatgcaaatgatgggctgccagcttt 398
||||||||||| ||||||||||||||||| || |||||||||||||||||
Sbjct: 75 ttctctatgtacattttccttccggatgccaaagatgggctgccagcttt 124
>gnl|LJGI|TC72280 weakly similar to UniRef100_Q8GT65 Cluster: Serpin-like protein;
n=1; Citrus x paradisi|Rep: Serpin-like protein - Citrus
paradisi (Grapefruit), partial (58%)
Length = 827
Score = 69.9 bits (35), Expect = 2e-11
Identities = 175/222 (78%), Gaps = 6/222 (2%)
Strand = Plus / Plus
Query: 40 gaagtggtcaatgaagttaatttgtgggctgaagaaaagacaaaggggcttatcaaagac 99
||||||| ||||||||||||| |||||||| || ||||||| || ||| |||||||
Sbjct: 458 gaagtggccaatgaagttaatgcatgggctgagaaagagacaaatggtcttgtcaaagat 517
Query: 100 attcttccttctggttcacttggcagcttcacaaggctcatttttgcaaattcactgtac 159
|||||||| |||| ||| ||| || || |||||||| ||||||||| || ||||
Sbjct: 518 cttcttcctgctgggtcagttgatgcctcaaccaggctcatctttgcaaatgcattgtat 577
Query: 160 ttcaaagctgcatggcaagagagagacaagtttaatgcatcaatgacaaaagagggtgat 219
||||||| ||||||| |||| ||||| |||| |||||||| ||||| |||||
Sbjct: 578 ttcaaaggtgcatggactgaga------agtttgatgcttcaatgactaaagactgtgat 631
Query: 220 tttcacattctgaatggcacatcagttaaggttccgttcatg 261
|||||| |||| ||||||| ||||| |||||||| ||||||
Sbjct: 632 tttcaccttcttgatggcacctcagtcaaggttcccttcatg 673
>gnl|LJGI|TC75793 similar to UniRef100_Q2HSM8 Cluster: Proteinase inhibitor I4,
serpin; n=1; Medicago truncatula|Rep: Proteinase
inhibitor I4, serpin - Medicago truncatula (Barrel
medic), partial (35%)
Length = 722
Score = 63.9 bits (32), Expect = 2e-09
Identities = 68/80 (85%)
Strand = Plus / Plus
Query: 754 gtagctgaccaccctttcttgttccttattagagaaagtttgtctggaactgtgttcttt 813
||||||||||| |||||| ||||||| || |||||| |||||||||||| | | |||
Sbjct: 422 gtagctgaccatcctttcatgttcctgatcagagaagatttgtctggaacaatactattt 481
Query: 814 attggacaggtgctcaatcc 833
||||| ||||||||||||||
Sbjct: 482 attgggcaggtgctcaatcc 501
Score = 56.0 bits (28), Expect = 4e-07
Identities = 121/152 (79%)
Strand = Plus / Plus
Query: 349 ttctctatgtatattttccttccggatgcaaatgatgggctgccagctttggttgagcga 408
||||| ||||| ||||| ||||| ||||||| |||||||| ||| |||||| ||||
Sbjct: 32 ttctccatgtacatttttcttccacatgcaaaaaatgggctgtcagatttggtggagctg 91
Query: 409 gtgacttctgaatctgggttcctagaacatcatcttcctgatagagaagtggaagtacga 468
|||||||| ||||||||||||| ||| | |||||| || |||| |||||| |
Sbjct: 92 gtgacttcaaaatctgggttcctcgaaagcaagcttcctaatcataaagttgaagtaggt 151
Query: 469 gacttcaggattccaaaattcaagttttcttt 500
|||||||||||||| |||||||| |||||||
Sbjct: 152 gacttcaggattcccaaattcaaaatttcttt 183
>gnl|LJGI|TC59164 weakly similar to UniRef100_Q2HSM8 Cluster: Proteinase inhibitor
I4, serpin; n=1; Medicago truncatula|Rep: Proteinase
inhibitor I4, serpin - Medicago truncatula (Barrel
medic), partial (40%)
Length = 819
Score = 61.9 bits (31), Expect = 6e-09
Identities = 94/115 (81%)
Strand = Plus / Plus
Query: 52 gaagttaatttgtgggctgaagaaaagacaaaggggcttatcaaagacattcttccttct 111
||||| ||||| |||||||| || ||||||| || |||||||||||| |||||||| ||
Sbjct: 655 gaagtgaatttatgggctgagaaagagacaaaaggccttatcaaagaccttcttcctcct 714
Query: 112 ggttcacttggcagcttcacaaggctcatttttgcaaattcactgtacttcaaag 166
|| ||| ||||| ||| || || || || |||| |||| || ||||||||||||
Sbjct: 715 gggtcagttggccacttaaccagacttatctttgtaaatgcattgtacttcaaag 769
>gnl|LJGI|TC77786 similar to UniRef100_Q8GT65 Cluster: Serpin-like protein; n=1;
Citrus x paradisi|Rep: Serpin-like protein - Citrus
paradisi (Grapefruit), partial (70%)
Length = 1367
Score = 58.0 bits (29), Expect = 9e-08
Identities = 44/49 (89%)
Strand = Plus / Plus
Query: 455 aagtggaagtacgagacttcaggattccaaaattcaagttttctttcgg 503
||||||||||| | |||||||||||||| |||||||| ||||||||||
Sbjct: 800 aagtggaagtaggtgacttcaggattcccaaattcaaaatttctttcgg 848
>gnl|LJGI|TC63990 similar to UniRef100_Q8GT65 Cluster: Serpin-like protein; n=1;
Citrus x paradisi|Rep: Serpin-like protein - Citrus
paradisi (Grapefruit), partial (16%)
Length = 831
Score = 58.0 bits (29), Expect = 9e-08
Identities = 74/89 (83%)
Strand = Plus / Plus
Query: 746 tagattttgtagctgaccaccctttcttgttccttattagagaaagtttgtctggaactg 805
|||| ||||||||||||||||||||||| ||| | || |||||| ||| |||||||
Sbjct: 411 tagactttgtagctgaccaccctttcttcttcttgatcagagaagattttactggaacaa 470
Query: 806 tgttctttattggacaggtgctcaatcct 834
| |||||||||| ||||||||| |||||
Sbjct: 471 ttctctttattgggcaggtgctccatcct 499
Score = 56.0 bits (28), Expect = 4e-07
Identities = 49/56 (87%)
Strand = Plus / Plus
Query: 343 cgccaattctctatgtatattttccttccggatgcaaatgatgggctgccagcttt 398
|||| |||||| ||||| |||||||||||||||||||| |||| ||||||||||
Sbjct: 20 cgccgattctccatgtacattttccttccggatgcaaaaaatggattgccagcttt 75
>gnl|LJGI|TC67954 similar to UniRef100_Q8GT65 Cluster: Serpin-like protein; n=1;
Citrus x paradisi|Rep: Serpin-like protein - Citrus
paradisi (Grapefruit), partial (31%)
Length = 781
Score = 52.0 bits (26), Expect = 6e-06
Identities = 74/90 (82%)
Strand = Plus / Plus
Query: 744 ggtagattttgtagctgaccaccctttcttgttccttattagagaaagtttgtctggaac 803
||||||||| |||||||||||||| ||||||||| | || |||||| |||| | |||||
Sbjct: 330 ggtagatttcgtagctgaccaccccttcttgttcgtgatcagagaagatttgaccggaac 389
Query: 804 tgtgttctttattggacaggtgctcaatcc 833
|| | |||| || ||||||||||||||
Sbjct: 390 agtactatttacagggcaggtgctcaatcc 419