Miyakogusa Predicted Gene

Lj1g3v1135190.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj1g3v1135190.1 tr|G7JXT8|G7JXT8_MEDTR Polygalacturonase
OS=Medicago truncatula GN=MTR_5g043350 PE=3 SV=1,60.1,0,Pectin
lyase-like,Pectin lyase fold/virulence factor; no description,Pectin
lyase fold; SUBFAMILY NO,CUFF.26860.1
         (642 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC80731 similar to UniRef100_Q2KMJ7 Cluster: PGN; n=2; ...   256   1e-67
gnl|LJGI|GO025452 similar to UniRef100_Q2KMJ7 Cluster: PGN; n=2;...   109   2e-23
gnl|LJGI|FS344139 similar to UniRef100_Q2KMJ7 Cluster: PGN; n=2;...    56   3e-07

>gnl|LJGI|TC80731 similar to UniRef100_Q2KMJ7 Cluster: PGN; n=2; Glycine max|Rep: PGN
           - Glycine max (Soybean), partial (35%)
          Length = 869

 Score =  256 bits (129), Expect = 1e-67
 Identities = 148/153 (96%), Gaps = 1/153 (0%)
 Strand = Plus / Plus

                                                                       
Query: 480 cagcccaagaaatcacataagtataagtacatgcagtgactctagcatttccaatattca 539
           ||||||||||| |||||||||||||||| ||||||||| |||||||||||||||||||||
Sbjct: 1   cagcccaagaa-tcacataagtataagttcatgcagtggctctagcatttccaatattca 59

                                                                       
Query: 540 tgttactgccccagaggaaagtcctaacaccgatgggattgatatctcaggatcaactaa 599
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 60  tgttactgccccagaggaaagtcctaacaccgatgggattgatatctcaggatcaactaa 119

                                            
Query: 600 catcctcattaaggattctacgatccgaactgg 632
           ||||||||||||||||||||| || ||||||||
Sbjct: 120 catcctcattaaggattctacaattcgaactgg 152


>gnl|LJGI|GO025452 similar to UniRef100_Q2KMJ7 Cluster: PGN; n=2; Glycine max|Rep: PGN
           - Glycine max (Soybean), partial (34%)
          Length = 623

 Score =  109 bits (55), Expect = 2e-23
 Identities = 118/139 (84%)
 Strand = Plus / Plus

                                                                       
Query: 471 tcacatcaacagcccaagaaatcacataagtataagtacatgcagtgactctagcatttc 530
           ||||||||||||||||  |||||| || || |||  | ||||||||||||||||| | ||
Sbjct: 22  tcacatcaacagcccacaaaatcatattagcatagcttcatgcagtgactctagcgtctc 81

                                                                       
Query: 531 caatattcatgttactgccccagaggaaagtcctaacaccgatgggattgatatctcagg 590
           |||   |||| ||| |||||||||| ||||||| ||||| || |||||||||||||||| 
Sbjct: 82  caacgctcatattattgccccagagaaaagtccaaacactgacgggattgatatctcaga 141

                              
Query: 591 atcaactaacatcctcatt 609
           |||| ||||||||||||||
Sbjct: 142 atcatctaacatcctcatt 160


>gnl|LJGI|FS344139 similar to UniRef100_Q2KMJ7 Cluster: PGN; n=2; Glycine max|Rep: PGN
           - Glycine max (Soybean), partial (25%)
          Length = 444

 Score = 56.0 bits (28), Expect = 3e-07
 Identities = 55/64 (85%)
 Strand = Plus / Plus

                                                                       
Query: 138 tgcaactcaaggtgccccaacacttctcatacccaaagggaaatcattcatgttgcaacc 197
           ||||||||| | | || |||||||  ||||||| ||||| ||| ||||||||||||||||
Sbjct: 152 tgcaactcatgatacctcaacactgatcatacctaaaggaaaaacattcatgttgcaacc 211

               
Query: 198 tgtg 201
           ||||
Sbjct: 212 tgtg 215