Miyakogusa Predicted Gene

Lj1g3v1134070.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj1g3v1134070.1 Non Chatacterized Hit- tr|I1KB69|I1KB69_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.54169
PE,78.85,2e-16,seg,NULL,CUFF.27146.1
         (159 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC79124 UniRef100_Q0VFG4 Cluster: Rogdi protein; n=1; X...   315   4e-86
gnl|LJGI|TC62896 weakly similar to UniRef100_A7Q3Y5 Cluster: Chr...   315   4e-86

>gnl|LJGI|TC79124 UniRef100_Q0VFG4 Cluster: Rogdi protein; n=1; Xenopus
           tropicalis|Rep: Rogdi protein - Xenopus tropicalis
           (Western clawed frog) (Silurana tropicalis), partial
           (8%)
          Length = 431

 Score =  315 bits (159), Expect = 4e-86
 Identities = 159/159 (100%)
 Strand = Plus / Plus

                                                                       
Query: 1   atggccggtctacctgcgaagcttcgtttccaaccagccgatgtcaaagccgccgccatg 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 117 atggccggtctacctgcgaagcttcgtttccaaccagccgatgtcaaagccgccgccatg 176

                                                                       
Query: 61  tggggcgttgccgccggcgccggcgctctctaccttgttcagccatggggctggttgagg 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 177 tggggcgttgccgccggcgccggcgctctctaccttgttcagccatggggctggttgagg 236

                                                  
Query: 121 aagaccttctttgagaagccagagcctgaacaaaaatga 159
           |||||||||||||||||||||||||||||||||||||||
Sbjct: 237 aagaccttctttgagaagccagagcctgaacaaaaatga 275


>gnl|LJGI|TC62896 weakly similar to UniRef100_A7Q3Y5 Cluster: Chromosome chr13
           scaffold_48, whole genome shotgun sequence; n=1; Vitis
           vinifera|Rep: Chromosome chr13 scaffold_48, whole genome
           shotgun sequence - Vitis vinifera (Grape), partial (75%)
          Length = 676

 Score =  315 bits (159), Expect = 4e-86
 Identities = 159/159 (100%)
 Strand = Plus / Plus

                                                                       
Query: 1   atggccggtctacctgcgaagcttcgtttccaaccagccgatgtcaaagccgccgccatg 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 23  atggccggtctacctgcgaagcttcgtttccaaccagccgatgtcaaagccgccgccatg 82

                                                                       
Query: 61  tggggcgttgccgccggcgccggcgctctctaccttgttcagccatggggctggttgagg 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 83  tggggcgttgccgccggcgccggcgctctctaccttgttcagccatggggctggttgagg 142

                                                  
Query: 121 aagaccttctttgagaagccagagcctgaacaaaaatga 159
           |||||||||||||||||||||||||||||||||||||||
Sbjct: 143 aagaccttctttgagaagccagagcctgaacaaaaatga 181