Miyakogusa Predicted Gene

Lj1g3v1091410.2
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj1g3v1091410.2 tr|G7IV38|G7IV38_MEDTR Cc-nbs-lrr resistance
protein OS=Medicago truncatula GN=MTR_3g062420 PE=4
SV=,56.41,0,NB-ARC,NB-ARC; no description,NULL; P-loop containing
nucleoside triphosphate hydrolases,NULL; L dom,CUFF.26812.2
         (2247 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC79626 weakly similar to UniRef100_Q38MJ7 Cluster: I2;...   220   3e-56

>gnl|LJGI|TC79626 weakly similar to UniRef100_Q38MJ7 Cluster: I2; n=1; Solanum
            melongena|Rep: I2 - Solanum melongena (Eggplant)
            (Aubergine), partial (13%)
          Length = 347

 Score =  220 bits (111), Expect = 3e-56
 Identities = 282/339 (83%)
 Strand = Plus / Plus

                                                                        
Query: 978  gggacgagaaatagcaaaagaatgcaaaggattaccggttgctattgcaattattgctag 1037
            |||||| ||||||||||||||||||||||||||||| ||||| ||| ||||| | ||| |
Sbjct: 9    gggacgtgaaatagcaaaagaatgcaaaggattaccagttgcgatttcaattgtcgctgg 68

                                                                        
Query: 1038 cagtttaaagggccaacaacgtcaggaggagtgggatgcagcgttaaaattcttgcggaa 1097
            |||||||||||| ||||||| |||||| |||||| |   ||| ||||||| ||||||| |
Sbjct: 69   cagtttaaagggacaacaacatcaggaagagtggaacttagccttaaaatccttgcggga 128

                                                                        
Query: 1098 tccttctggatccatgctcggtattgatgaaaattcagttgaaatttataaatgtttcag 1157
             |||  |  |||||||  |||  |||||||||||||| |||||||||||||||| || | 
Sbjct: 129  gcctcttaaatccatgtccggcgttgatgaaaattcaattgaaatttataaatgattgaa 188

                                                                        
Query: 1158 gtttagttatgattacataaaggatgaaaaatccaagggattgttcctcttattttctgt 1217
            |||||| |  ||| |  |||||||||||||| |||||  | | |||||||||||||||||
Sbjct: 189  gtttagcttcgataatctaaaggatgaaaaagccaagaaactattcctcttattttctgt 248

                                                                        
Query: 1218 attcccagaagacaagcaagttcctaatgaactttttactagatttggcataggagtagg 1277
            ||||||||||||||   ||||||||||||||||||| || ||||| || || ||||  ||
Sbjct: 249  attcccagaagacactgaagttcctaatgaacttttgacaagattggggattggagcggg 308

                                                   
Query: 1278 catatttggggaagttggtggcaaatatgatgatactcg 1316
             || || |||||| |||||| ||||||||||||| ||||
Sbjct: 309  aattttcggggaacttggtgacaaatatgatgatgctcg 347