Miyakogusa Predicted Gene
- Lj1g3v1091080.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj1g3v1091080.1 Non Chatacterized Hit- tr|I3STS5|I3STS5_LOTJA
Uncharacterized protein OS=Lotus japonicus PE=2 SV=1,100,0,no
description,NULL; Zn-dependent exopeptidases,NULL; Bacterial
exopeptidase dimerisation domain,Pep,CUFF.26790.1
(963 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC73422 similar to UniRef100_Q0GXX5 Cluster: Auxin conj... 599 e-170
gnl|LJGI|TC81028 similar to UniRef100_Q0GXX4 Cluster: Auxin conj... 70 3e-11
gnl|LJGI|TC68278 similar to UniRef100_Q0GXX4 Cluster: Auxin conj... 60 3e-08
gnl|LJGI|TC67055 similar to UniRef100_Q0GXX4 Cluster: Auxin conj... 54 2e-06
gnl|LJGI|CB828320 similar to UniRef100_Q0GXX4 Cluster: Auxin con... 52 7e-06
gnl|LJGI|TC66612 similar to UniRef100_Q0GXX4 Cluster: Auxin conj... 52 7e-06
>gnl|LJGI|TC73422 similar to UniRef100_Q0GXX5 Cluster: Auxin conjugate hydrolase;
n=1; Medicago truncatula|Rep: Auxin conjugate hydrolase
- Medicago truncatula (Barrel medic), partial (43%)
Length = 692
Score = 599 bits (302), Expect = e-170
Identities = 330/334 (98%), Gaps = 4/334 (1%)
Strand = Plus / Plus
Query: 1 atggatgcacttcctttgcaggagcttgttgagtgggagcacaagagcaaaattgatggc 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 352 atggatgcacttcctttgcaggagcttgttgagtgggagcacaagagcaaaattgatggc 411
Query: 61 agaat-gcatgcttgtggacatgatgctcatacaacaatgctacttgggg-ctgcaaagt 118
||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 412 agaattgcatgcttgtggacatgatgctcatacaacaatgctacttgggggctgcaaagt 471
Query: 119 tgctg-catcagcgcc-aagataaacttcagggaactgtgagacttatttttcaaccagc 176
||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 472 tgctggcatcagcgcccaagataaacttcagggaactgtgagacttatttttcaaccagc 531
Query: 177 tgaggagggagctaggggcgcctctcaagtgataaaagaaggagttcttcaagatacaga 236
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 532 tgaggagggagctaggggcgcctctcaagtgataaaagaaggagttcttcaagatacaga 591
Query: 237 agcaattttcgctgttcatattgatgctgagacgcctactggagccatagcatccattcc 296
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 592 agcaattttcgctgttcatattgatgctgagacgcctactggagccatagcatccattcc 651
Query: 297 agggccttttacagctgctggatgcatctttgag 330
||||||||||||||||||||||||||||||||||
Sbjct: 652 agggccttttacagctgctggatgcatctttgag 685
>gnl|LJGI|TC81028 similar to UniRef100_Q0GXX4 Cluster: Auxin conjugate hydrolase;
n=1; Medicago truncatula|Rep: Auxin conjugate hydrolase
- Medicago truncatula (Barrel medic), partial (63%)
Length = 963
Score = 69.9 bits (35), Expect = 3e-11
Identities = 71/83 (85%)
Strand = Plus / Plus
Query: 31 gagtgggagcacaagagcaaaattgatggcagaatgcatgcttgtggacatgatgctcat 90
||||||||||||| ||| || | ||||| | |||||||||||||| ||||||||||||
Sbjct: 402 gagtgggagcacatgagtcaagtagatggaaagatgcatgcttgtggtcatgatgctcat 461
Query: 91 acaacaatgctacttggggctgc 113
|| |||||||| ||||| |||||
Sbjct: 462 actacaatgcttcttggtgctgc 484
>gnl|LJGI|TC68278 similar to UniRef100_Q0GXX4 Cluster: Auxin conjugate hydrolase;
n=1; Medicago truncatula|Rep: Auxin conjugate hydrolase
- Medicago truncatula (Barrel medic), partial (39%)
Length = 643
Score = 60.0 bits (30), Expect = 3e-08
Identities = 48/54 (88%)
Strand = Plus / Plus
Query: 64 atgcatgcttgtggacatgatgctcatacaacaatgctacttggggctgcaaag 117
|||||||| ||||| |||||||||||||| || ||||| ||||| |||||||||
Sbjct: 435 atgcatgcatgtggtcatgatgctcatactaccatgcttcttggtgctgcaaag 488
>gnl|LJGI|TC67055 similar to UniRef100_Q0GXX4 Cluster: Auxin conjugate hydrolase;
n=1; Medicago truncatula|Rep: Auxin conjugate hydrolase
- Medicago truncatula (Barrel medic), partial (59%)
Length = 853
Score = 54.0 bits (27), Expect = 2e-06
Identities = 72/87 (82%)
Strand = Plus / Plus
Query: 31 gagtgggagcacaagagcaaaattgatggcagaatgcatgcttgtggacatgatgctcat 90
||||||||||||| |||| || | ||||| | ||||| | ||||| ||||||||||||
Sbjct: 393 gagtgggagcacatgagccaagtagatgggaagatgcactcatgtggtcatgatgctcat 452
Query: 91 acaacaatgctacttggggctgcaaag 117
|| |||||| | ||||| |||||||||
Sbjct: 453 actacaatggttcttggtgctgcaaag 479
>gnl|LJGI|CB828320 similar to UniRef100_Q0GXX4 Cluster: Auxin conjugate hydrolase;
n=1; Medicago truncatula|Rep: Auxin conjugate hydrolase
- Medicago truncatula (Barrel medic), partial (39%)
Length = 521
Score = 52.0 bits (26), Expect = 7e-06
Identities = 47/54 (87%)
Strand = Plus / Plus
Query: 64 atgcatgcttgtggacatgatgctcatacaacaatgctacttggggctgcaaag 117
||||| |||||||| ||||||||||||| || ||||| ||||| |||||||||
Sbjct: 105 atgcacgcttgtggtcatgatgctcatattaccatgcttcttggtgctgcaaag 158
>gnl|LJGI|TC66612 similar to UniRef100_Q0GXX4 Cluster: Auxin conjugate hydrolase;
n=1; Medicago truncatula|Rep: Auxin conjugate hydrolase
- Medicago truncatula (Barrel medic), partial (51%)
Length = 806
Score = 52.0 bits (26), Expect = 7e-06
Identities = 47/54 (87%)
Strand = Plus / Plus
Query: 64 atgcatgcttgtggacatgatgctcatacaacaatgctacttggggctgcaaag 117
||||| |||||||| ||||||||||||| || ||||| ||||| |||||||||
Sbjct: 442 atgcacgcttgtggtcatgatgctcatattaccatgcttcttggtgctgcaaag 495