Miyakogusa Predicted Gene

Lj1g3v1035300.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj1g3v1035300.1 tr|Q45W78|Q45W78_ARAHY Ubiquitin fusion protein
OS=Arachis hypogaea PE=2 SV=1,99.22,0,no description,NULL;
UBIQUITIN_2,Ubiquitin supergroup; UBIQUITIN,NULL; ubiquitin,Ubiquitin;
Ribosoma,CUFF.26717.1
         (390 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC64454 UniRef100_Q45W78 Cluster: Ubiquitin fusion prot...   773   0.0  
gnl|LJGI|BW604401 UniRef100_A0MKC8 Cluster: Ubiquitin extension ...   226   8e-59
gnl|LJGI|BW629410 UniRef100_A1X1E5 Cluster: Polyubiquitin; n=1; ...   226   8e-59
gnl|LJGI|BW620072 UniRef100_A0MKC8 Cluster: Ubiquitin extension ...   226   8e-59
gnl|LJGI|TC81113 UniRef100_A1X1E5 Cluster: Polyubiquitin; n=1; T...   226   8e-59
gnl|LJGI|TC79728 UniRef100_Q7EUR6 Cluster: AT4g05320/C17L7_240; ...   226   8e-59
gnl|LJGI|TC65553 UniRef100_Q45W78 Cluster: Ubiquitin fusion prot...   226   8e-59
gnl|LJGI|TC66444 UniRef100_Q45W78 Cluster: Ubiquitin fusion prot...   222   1e-57
gnl|LJGI|TC62585 UniRef100_Q45W78 Cluster: Ubiquitin fusion prot...   222   1e-57
gnl|LJGI|BW623364 homologue to UniRef100_A1CKM6 Cluster: Ubiquit...   218   2e-56
gnl|LJGI|TC79823 UniRef100_A1X1E5 Cluster: Polyubiquitin; n=1; T...   218   2e-56
gnl|LJGI|TC82572 homologue to UniRef100_A1X1E5 Cluster: Polyubiq...   210   5e-54
gnl|LJGI|BW629347 UniRef100_A1X1E5 Cluster: Polyubiquitin; n=1; ...   202   1e-51
gnl|LJGI|TC64176 homologue to UniRef100_A0MKC8 Cluster: Ubiquiti...   202   1e-51
gnl|LJGI|TC79910 UniRef100_A1X1E5 Cluster: Polyubiquitin; n=1; T...   176   7e-44
gnl|LJGI|TC62881 homologue to UniRef100_Q06H21 Cluster: Ubiquiti...   170   4e-42
gnl|LJGI|TC76922 homologue to UniRef100_A7QD64 Cluster: Chromoso...   139   1e-32
gnl|LJGI|AV407232 UniRef100_A0MKC8 Cluster: Ubiquitin extension ...   123   9e-28
gnl|LJGI|TC78962 UniRef100_Q42397 Cluster: Hexaubiquitin protein...   123   9e-28
gnl|LJGI|BW623815 UniRef100_A1X1E5 Cluster: Polyubiquitin; n=1; ...   107   5e-23
gnl|LJGI|TC77422 UniRef100_Q7EUR6 Cluster: AT4g05320/C17L7_240; ...   107   5e-23
gnl|LJGI|TC71652 UniRef100_A1X1E5 Cluster: Polyubiquitin; n=1; T...   107   5e-23
gnl|LJGI|TC67537 UniRef100_Q7EUR6 Cluster: AT4g05320/C17L7_240; ...   107   5e-23
gnl|LJGI|BW626875 homologue to UniRef100_A1X1E5 Cluster: Polyubi...   100   1e-20
gnl|LJGI|TC60580 UniRef100_Q42397 Cluster: Hexaubiquitin protein...   100   1e-20
gnl|LJGI|TC80080 UniRef100_A1X1E5 Cluster: Polyubiquitin; n=1; T...    84   7e-16
gnl|LJGI|BW623042 UniRef100_A1X1E5 Cluster: Polyubiquitin; n=1; ...    76   2e-13
gnl|LJGI|TC81636 UniRef100_A4US66 Cluster: Ubiquitin B; n=2; Coe...    74   7e-13
gnl|LJGI|FS360056 homologue to UniRef100_A3LZJ4 Cluster: Predict...    72   3e-12
gnl|LJGI|TC81524 homologue to UniRef100_A1X1E5 Cluster: Polyubiq...    70   1e-11
gnl|LJGI|TC81522 homologue to UniRef100_A1X1E5 Cluster: Polyubiq...    70   1e-11
gnl|LJGI|AV422262 UniRef100_A0MKC8 Cluster: Ubiquitin extension ...    62   3e-09

>gnl|LJGI|TC64454 UniRef100_Q45W78 Cluster: Ubiquitin fusion protein; n=3; core
           eudicotyledons|Rep: Ubiquitin fusion protein - Arachis
           hypogaea (Peanut), complete
          Length = 664

 Score =  773 bits (390), Expect = 0.0
 Identities = 390/390 (100%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgcagatcttcgtgaaaaccctgaccggcaagaccatcaccctcgaggtggagtcaagc 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 46  atgcagatcttcgtgaaaaccctgaccggcaagaccatcaccctcgaggtggagtcaagc 105

                                                                       
Query: 61  gacaccatcgacaacgtcaaagcgaagatccaggacaaagaagggattccaccggaccag 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 106 gacaccatcgacaacgtcaaagcgaagatccaggacaaagaagggattccaccggaccag 165

                                                                       
Query: 121 cagaggttgatcttcgccgggaagcagcttgaggatggccgtaccctcgccgattacaac 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 166 cagaggttgatcttcgccgggaagcagcttgaggatggccgtaccctcgccgattacaac 225

                                                                       
Query: 181 atccagaaagagtcaaccttgcatcttgttttgaggcttcgtggtggcattattgagcca 240
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 226 atccagaaagagtcaaccttgcatcttgttttgaggcttcgtggtggcattattgagcca 285

                                                                       
Query: 241 tctctgatggcattggccaggaagtataaccaggacaagatgatctgccgcaagtgttat 300
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 286 tctctgatggcattggccaggaagtataaccaggacaagatgatctgccgcaagtgttat 345

                                                                       
Query: 301 gcacgtctgcatccccgtgctgtcaactgcaggaaaaagaagtgtggacacagcaaccag 360
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 346 gcacgtctgcatccccgtgctgtcaactgcaggaaaaagaagtgtggacacagcaaccag 405

                                         
Query: 361 ttgaggccgaagaagaagatcaagtaaact 390
           ||||||||||||||||||||||||||||||
Sbjct: 406 ttgaggccgaagaagaagatcaagtaaact 435


>gnl|LJGI|BW604401 UniRef100_A0MKC8 Cluster: Ubiquitin extension protein; n=2; core
           eudicotyledons|Rep: Ubiquitin extension protein -
           Capsicum annuum (Bell pepper), partial (43%)
          Length = 339

 Score =  226 bits (114), Expect = 8e-59
 Identities = 177/198 (89%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgcagatcttcgtgaaaaccctgaccggcaagaccatcaccctcgaggtggagtcaagc 60
           ||||||||||||||||| ||||| ||||| ||||||||||| |||||||| |||     |
Sbjct: 112 atgcagatcttcgtgaagaccctcaccggaaagaccatcactctcgaggtcgagagctcc 171

                                                                       
Query: 61  gacaccatcgacaacgtcaaagcgaagatccaggacaaagaagggattccaccggaccag 120
           ||||||||||||||||| || || ||||||||||| || || |||||||| |||||||||
Sbjct: 172 gacaccatcgacaacgttaaggcaaagatccaggataaggaggggattcccccggaccag 231

                                                                       
Query: 121 cagaggttgatcttcgccgggaagcagcttgaggatggccgtaccctcgccgattacaac 180
           |||||||||||||||||||| ||||||||||||||||| |||||||||||||| ||||||
Sbjct: 232 cagaggttgatcttcgccggaaagcagcttgaggatggtcgtaccctcgccgactacaac 291

                             
Query: 181 atccagaaagagtcaacc 198
           |||||||| |||||||||
Sbjct: 292 atccagaaggagtcaacc 309


>gnl|LJGI|BW629410 UniRef100_A1X1E5 Cluster: Polyubiquitin; n=1; Thlaspi
           caerulescens|Rep: Polyubiquitin - Thlaspi caerulescens
           (Alpine penny-cress) (Thlaspi calaminare), partial (31%)
          Length = 477

 Score =  226 bits (114), Expect = 8e-59
 Identities = 177/198 (89%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgcagatcttcgtgaaaaccctgaccggcaagaccatcaccctcgaggtggagtcaagc 60
           ||||||||||||||||| ||||| ||||| ||||||||||| |||||||| |||     |
Sbjct: 124 atgcagatcttcgtgaagaccctcaccggaaagaccatcactctcgaggtcgagagctcc 183

                                                                       
Query: 61  gacaccatcgacaacgtcaaagcgaagatccaggacaaagaagggattccaccggaccag 120
           ||||||||||||||||| || || ||||||||||| || || |||||||| |||||||||
Sbjct: 184 gacaccatcgacaacgttaaggcaaagatccaggataaggaggggattcccccggaccag 243

                                                                       
Query: 121 cagaggttgatcttcgccgggaagcagcttgaggatggccgtaccctcgccgattacaac 180
           |||||||||||||||||||| ||||||||||||||||| |||||||||||||| ||||||
Sbjct: 244 cagaggttgatcttcgccggaaagcagcttgaggatggtcgtaccctcgccgactacaac 303

                             
Query: 181 atccagaaagagtcaacc 198
           |||||||| |||||||||
Sbjct: 304 atccagaaggagtcaacc 321



 Score =  105 bits (53), Expect = 2e-22
 Identities = 111/129 (86%), Gaps = 6/129 (4%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgcagatcttcgtgaaaaccctgaccggcaagaccatcaccctcgaggtggagtcaagc 60
           ||||||||||||||||| ||||| |||||||||||||||||||||||||| ||   ||||
Sbjct: 352 atgcagatcttcgtgaagaccctcaccggcaagaccatcaccctcgaggtcga---aagc 408

                                                                       
Query: 61  ---gacaccatcgacaacgtcaaagcgaagatccaggacaaagaagggattccaccggac 117
              ||||| || ||||||||||| || |||||||||||||| || || ||||| ||||| 
Sbjct: 409 tctgacactattgacaacgtcaaggctaagatccaggacaaggagggaattcccccggat 468

                    
Query: 118 cagcagagg 126
           |||||||||
Sbjct: 469 cagcagagg 477


>gnl|LJGI|BW620072 UniRef100_A0MKC8 Cluster: Ubiquitin extension protein; n=2; core
           eudicotyledons|Rep: Ubiquitin extension protein -
           Capsicum annuum (Bell pepper), partial (43%)
          Length = 336

 Score =  226 bits (114), Expect = 8e-59
 Identities = 177/198 (89%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgcagatcttcgtgaaaaccctgaccggcaagaccatcaccctcgaggtggagtcaagc 60
           ||||||||||||||||| ||||| ||||| ||||||||||| |||||||| |||     |
Sbjct: 109 atgcagatcttcgtgaagaccctcaccggaaagaccatcactctcgaggtcgagagctcc 168

                                                                       
Query: 61  gacaccatcgacaacgtcaaagcgaagatccaggacaaagaagggattccaccggaccag 120
           ||||||||||||||||| || || ||||||||||| || || |||||||| |||||||||
Sbjct: 169 gacaccatcgacaacgttaaggcaaagatccaggataaggaggggattcccccggaccag 228

                                                                       
Query: 121 cagaggttgatcttcgccgggaagcagcttgaggatggccgtaccctcgccgattacaac 180
           |||||||||||||||||||| ||||||||||||||||| |||||||||||||| ||||||
Sbjct: 229 cagaggttgatcttcgccggaaagcagcttgaggatggtcgtaccctcgccgactacaac 288

                             
Query: 181 atccagaaagagtcaacc 198
           |||||||| |||||||||
Sbjct: 289 atccagaaggagtcaacc 306


>gnl|LJGI|TC81113 UniRef100_A1X1E5 Cluster: Polyubiquitin; n=1; Thlaspi
           caerulescens|Rep: Polyubiquitin - Thlaspi caerulescens
           (Alpine penny-cress) (Thlaspi calaminare), partial (67%)
          Length = 881

 Score =  226 bits (114), Expect = 8e-59
 Identities = 177/198 (89%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgcagatcttcgtgaaaaccctgaccggcaagaccatcaccctcgaggtggagtcaagc 60
           ||||||||||||||||| ||||| ||||| ||||||||||| |||||||| |||     |
Sbjct: 110 atgcagatcttcgtgaagaccctcaccggaaagaccatcactctcgaggtcgagagctcc 169

                                                                       
Query: 61  gacaccatcgacaacgtcaaagcgaagatccaggacaaagaagggattccaccggaccag 120
           ||||||||||||||||| || || ||||||||||| || || |||||||| |||||||||
Sbjct: 170 gacaccatcgacaacgttaaggcaaagatccaggataaggaggggattcccccggaccag 229

                                                                       
Query: 121 cagaggttgatcttcgccgggaagcagcttgaggatggccgtaccctcgccgattacaac 180
           |||||||||||||||||||| ||||||||||||||||| |||||||||||||| ||||||
Sbjct: 230 cagaggttgatcttcgccggaaagcagcttgaggatggtcgtaccctcgccgactacaac 289

                             
Query: 181 atccagaaagagtcaacc 198
           |||||||| |||||||||
Sbjct: 290 atccagaaggagtcaacc 307



 Score =  168 bits (85), Expect = 2e-41
 Identities = 170/197 (86%), Gaps = 6/197 (3%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgcagatcttcgtgaaaaccctgaccggcaagaccatcaccctcgaggtggagtcaagc 60
           ||||||||||||||||| ||||| || ||||||||||||||||||||||| ||   ||||
Sbjct: 338 atgcagatcttcgtgaagaccctcactggcaagaccatcaccctcgaggtcga---aagc 394

                                                                       
Query: 61  ---gacaccatcgacaacgtcaaagcgaagatccaggacaaagaagggattccaccggac 117
              ||||| || ||||||||||| || |||||||||||||| || || ||||| ||||| 
Sbjct: 395 tctgacactattgacaacgtcaaggctaagatccaggacaaggagggaattcccccggat 454

                                                                       
Query: 118 cagcagaggttgatcttcgccgggaagcagcttgaggatggccgtaccctcgccgattac 177
           ||||||||||||||||||||||| |||||||| |||||||| || ||| | ||||| |||
Sbjct: 455 cagcagaggttgatcttcgccggcaagcagctcgaggatggtcgcaccttggccgactac 514

                            
Query: 178 aacatccagaaagagtc 194
           ||||||||||| |||||
Sbjct: 515 aacatccagaaggagtc 531



 Score =  151 bits (76), Expect = 4e-36
 Identities = 160/188 (85%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgcagatcttcgtgaaaaccctgaccggcaagaccatcaccctcgaggtggagtcaagc 60
           |||||||||||||| || ||| |||| ||||||||||||||||| ||||| |||      
Sbjct: 566 atgcagatcttcgtcaagaccttgactggcaagaccatcacccttgaggttgagagctct 625

                                                                       
Query: 61  gacaccatcgacaacgtcaaagcgaagatccaggacaaagaagggattccaccggaccag 120
           |||||||||||||||||||| || |||||||| ||||| || || || || |||||||||
Sbjct: 626 gacaccatcgacaacgtcaaggctaagatccaagacaaggagggaatccccccggaccag 685

                                                                       
Query: 121 cagaggttgatcttcgccgggaagcagcttgaggatggccgtaccctcgccgattacaac 180
           |||||||||||||| ||||| |||||||| |||||||| || ||||| || || ||||||
Sbjct: 686 cagaggttgatctttgccggcaagcagctcgaggatggtcgcacccttgctgactacaac 745

                   
Query: 181 atccagaa 188
           ||||||||
Sbjct: 746 atccagaa 753


>gnl|LJGI|TC79728 UniRef100_Q7EUR6 Cluster: AT4g05320/C17L7_240; n=8; core
           eudicotyledons|Rep: AT4g05320/C17L7_240 - Arabidopsis
           thaliana (Mouse-ear cress), complete
          Length = 1440

 Score =  226 bits (114), Expect = 8e-59
 Identities = 177/198 (89%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgcagatcttcgtgaaaaccctgaccggcaagaccatcaccctcgaggtggagtcaagc 60
           ||||||||||||||||| ||||| ||||| ||||||||||| |||||||| |||     |
Sbjct: 101 atgcagatcttcgtgaagaccctcaccggaaagaccatcactctcgaggtcgagagctcc 160

                                                                       
Query: 61  gacaccatcgacaacgtcaaagcgaagatccaggacaaagaagggattccaccggaccag 120
           ||||||||||||||||| || || ||||||||||| || || |||||||| |||||||||
Sbjct: 161 gacaccatcgacaacgttaaggcaaagatccaggataaggaggggattcccccggaccag 220

                                                                       
Query: 121 cagaggttgatcttcgccgggaagcagcttgaggatggccgtaccctcgccgattacaac 180
           |||||||||||||||||||| ||||||||||||||||| |||||||||||||| ||||||
Sbjct: 221 cagaggttgatcttcgccggaaagcagcttgaggatggtcgtaccctcgccgactacaac 280

                             
Query: 181 atccagaaagagtcaacc 198
           |||||||| |||||||||
Sbjct: 281 atccagaaggagtcaacc 298



 Score =  168 bits (85), Expect = 2e-41
 Identities = 170/197 (86%), Gaps = 6/197 (3%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgcagatcttcgtgaaaaccctgaccggcaagaccatcaccctcgaggtggagtcaagc 60
           ||||||||||||||||| ||||| || ||||||||||||||||||||||| ||   ||||
Sbjct: 329 atgcagatcttcgtgaagaccctcactggcaagaccatcaccctcgaggtcga---aagc 385

                                                                       
Query: 61  ---gacaccatcgacaacgtcaaagcgaagatccaggacaaagaagggattccaccggac 117
              ||||| || ||||||||||| || |||||||||||||| || || ||||| ||||| 
Sbjct: 386 tctgacactattgacaacgtcaaggctaagatccaggacaaggagggaattcccccggat 445

                                                                       
Query: 118 cagcagaggttgatcttcgccgggaagcagcttgaggatggccgtaccctcgccgattac 177
           ||||||||||||||||||||||| |||||||| |||||||| || ||| | ||||| |||
Sbjct: 446 cagcagaggttgatcttcgccggcaagcagctcgaggatggtcgcaccttggccgactac 505

                            
Query: 178 aacatccagaaagagtc 194
           ||||||||||| |||||
Sbjct: 506 aacatccagaaggagtc 522



 Score =  151 bits (76), Expect = 4e-36
 Identities = 160/188 (85%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgcagatcttcgtgaaaaccctgaccggcaagaccatcaccctcgaggtggagtcaagc 60
           |||||||||||||| || ||| |||| ||||||||||||||||| ||||| |||      
Sbjct: 557 atgcagatcttcgtcaagaccttgactggcaagaccatcacccttgaggttgagagctct 616

                                                                       
Query: 61  gacaccatcgacaacgtcaaagcgaagatccaggacaaagaagggattccaccggaccag 120
           |||||||||||||||||||| || |||||||| ||||| || || || || |||||||||
Sbjct: 617 gacaccatcgacaacgtcaaggctaagatccaagacaaggagggaatccccccggaccag 676

                                                                       
Query: 121 cagaggttgatcttcgccgggaagcagcttgaggatggccgtaccctcgccgattacaac 180
           |||||||||||||| ||||| |||||||| |||||||| || ||||| || || ||||||
Sbjct: 677 cagaggttgatctttgccggcaagcagctcgaggatggtcgcacccttgctgactacaac 736

                   
Query: 181 atccagaa 188
           ||||||||
Sbjct: 737 atccagaa 744



 Score =  107 bits (54), Expect = 5e-23
 Identities = 159/194 (81%)
 Strand = Plus / Plus

                                                                        
Query: 1    atgcagatcttcgtgaaaaccctgaccggcaagaccatcaccctcgaggtggagtcaagc 60
            ||||||||||| ||||| ||| |||| || |||||||| ||||| |||||||||     |
Sbjct: 1013 atgcagatctttgtgaagaccttgactggtaagaccattaccctggaggtggagagctcc 1072

                                                                        
Query: 61   gacaccatcgacaacgtcaaagcgaagatccaggacaaagaagggattccaccggaccag 120
            || ||||| |||||||| || || || || || ||||| ||||| || ||||||||||||
Sbjct: 1073 gataccattgacaacgtgaaggcaaaaattcaagacaaggaaggtatcccaccggaccag 1132

                                                                        
Query: 121  cagaggttgatcttcgccgggaagcagcttgaggatggccgtaccctcgccgattacaac 180
            |||||||||||||| || ||||||||| | ||||||||  | ||||| || || ||||||
Sbjct: 1133 cagaggttgatctttgcagggaagcagttggaggatggaaggacccttgctgactacaac 1192

                          
Query: 181  atccagaaagagtc 194
            || ||||| |||||
Sbjct: 1193 attcagaaggagtc 1206



 Score =  105 bits (53), Expect = 2e-22
 Identities = 170/209 (81%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgcagatcttcgtgaaaaccctgaccggcaagaccatcaccctcgaggtggagtcaagc 60
           |||||||| |||||||| ||  |||| || ||||||||||| || |||||||||      
Sbjct: 785 atgcagattttcgtgaagactttgactggtaagaccatcactcttgaggtggagagctct 844

                                                                       
Query: 61  gacaccatcgacaacgtcaaagcgaagatccaggacaaagaagggattccaccggaccag 120
           |||||||| |||||||| || || ||||||||||| || || || ||||| ||||| |||
Sbjct: 845 gacaccattgacaacgtgaaggctaagatccaggataaggagggtattcccccggatcag 904

                                                                       
Query: 121 cagaggttgatcttcgccgggaagcagcttgaggatggccgtaccctcgccgattacaac 180
           ||||||||||| || || || |||||||| ||||||||  | || || || |||||||||
Sbjct: 905 cagaggttgatttttgctggtaagcagctcgaggatggaaggactcttgcggattacaac 964

                                        
Query: 181 atccagaaagagtcaaccttgcatcttgt 209
           |||||||| ||||| ||| | ||||||||
Sbjct: 965 atccagaaggagtccacccttcatcttgt 993


>gnl|LJGI|TC65553 UniRef100_Q45W78 Cluster: Ubiquitin fusion protein; n=3; core
           eudicotyledons|Rep: Ubiquitin fusion protein - Arachis
           hypogaea (Peanut), complete
          Length = 627

 Score =  226 bits (114), Expect = 8e-59
 Identities = 321/390 (82%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgcagatcttcgtgaaaaccctgaccggcaagaccatcaccctcgaggtggagtcaagc 60
           |||||||| |||||||||||||| || || || |||||||| |||||||| |||   || 
Sbjct: 41  atgcagattttcgtgaaaaccctaactgggaaaaccatcactctcgaggtcgagagcagt 100

                                                                       
Query: 61  gacaccatcgacaacgtcaaagcgaagatccaggacaaagaagggattccaccggaccag 120
           |||||||||||||| ||||| || ||||| || ||||| ||||| ||||||||||| |||
Sbjct: 101 gacaccatcgacaatgtcaaggccaagattcaagacaaggaaggcattccaccggatcag 160

                                                                       
Query: 121 cagaggttgatcttcgccgggaagcagcttgaggatggccgtaccctcgccgattacaac 180
           ||| |  | || ||||| |||||||||||||| |||||  | ||| | || |||||||||
Sbjct: 161 cagcgtctcattttcgctgggaagcagcttgaagatggaagaaccttggctgattacaac 220

                                                                       
Query: 181 atccagaaagagtcaaccttgcatcttgttttgaggcttcgtggtggcattattgagcca 240
           || || || || || ||  | ||||||||  |||| |||||||| || || |||||||| 
Sbjct: 221 attcaaaaggaatccacgcttcatcttgtgctgagacttcgtgggggtatcattgagcct 280

                                                                       
Query: 241 tctctgatggcattggccaggaagtataaccaggacaagatgatctgccgcaagtgttat 300
           ||  ||||||| |||||  | || || || ||||||||||||||||||||||| || |||
Sbjct: 281 tcattgatggctttggctcgcaaatacaatcaggacaagatgatctgccgcaaatgctat 340

                                                                       
Query: 301 gcacgtctgcatccccgtgctgtcaactgcaggaaaaagaagtgtggacacagcaaccag 360
           || |||||||||||  | ||||| |||||| | |||||||||||||| ||||| || |||
Sbjct: 341 gctcgtctgcatccaagggctgtaaactgccgcaaaaagaagtgtggtcacagtaatcag 400

                                         
Query: 361 ttgaggccgaagaagaagatcaagtaaact 390
           |||||||| |||||||||||||||||||||
Sbjct: 401 ttgaggccaaagaagaagatcaagtaaact 430


>gnl|LJGI|TC66444 UniRef100_Q45W78 Cluster: Ubiquitin fusion protein; n=3; core
           eudicotyledons|Rep: Ubiquitin fusion protein - Arachis
           hypogaea (Peanut), complete
          Length = 674

 Score =  222 bits (112), Expect = 1e-57
 Identities = 319/388 (82%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgcagatcttcgtgaaaaccctgaccggcaagaccatcaccctcgaggtggagtcaagc 60
           |||||||| |||||||||||||| || || |||||||| ||||| ||||| |||   |||
Sbjct: 53  atgcagatattcgtgaaaaccctaactgggaagaccataacccttgaggtcgagagcagc 112

                                                                       
Query: 61  gacaccatcgacaacgtcaaagcgaagatccaggacaaagaagggattccaccggaccag 120
           |||||||| ||||| |||||||| ||||| || ||||||||||| ||||||||||| |||
Sbjct: 113 gacaccattgacaatgtcaaagctaagattcaagacaaagaaggcattccaccggatcag 172

                                                                       
Query: 121 cagaggttgatcttcgccgggaagcagcttgaggatggccgtaccctcgccgattacaac 180
           ||| | |||||||||||||| |||||||| || ||||| || ||||| || |||||||||
Sbjct: 173 cagcgtttgatcttcgccggaaagcagctggaagatgggcgaaccctagcggattacaac 232

                                                                       
Query: 181 atccagaaagagtcaaccttgcatcttgttttgaggcttcgtggtggcattattgagcca 240
           |||||||| || |||||  | ||||||||  | |||||||| ||||| || ||||| || 
Sbjct: 233 atccagaaggaatcaactcttcatcttgtcctcaggcttcgcggtggtatcattgaacct 292

                                                                       
Query: 241 tctctgatggcattggccaggaagtataaccaggacaagatgatctgccgcaagtgttat 300
           ||  |||||||  | ||  | || || || || ||||||||||| |||||||| || |||
Sbjct: 293 tcattgatggctcttgctcgcaaatacaatcaagacaagatgatttgccgcaaatgctat 352

                                                                       
Query: 301 gcacgtctgcatccccgtgctgtcaactgcaggaaaaagaagtgtggacacagcaaccag 360
           || ||| | |||||  | || || |||||| | |||||||||||||| || || || |||
Sbjct: 353 gctcgtttacatccgagagccgtgaactgccgcaaaaagaagtgtggtcatagtaatcag 412

                                       
Query: 361 ttgaggccgaagaagaagatcaagtaaa 388
           |||||||| |||||||||||||||||||
Sbjct: 413 ttgaggccaaagaagaagatcaagtaaa 440


>gnl|LJGI|TC62585 UniRef100_Q45W78 Cluster: Ubiquitin fusion protein; n=3; core
           eudicotyledons|Rep: Ubiquitin fusion protein - Arachis
           hypogaea (Peanut), complete
          Length = 718

 Score =  222 bits (112), Expect = 1e-57
 Identities = 319/388 (82%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgcagatcttcgtgaaaaccctgaccggcaagaccatcaccctcgaggtggagtcaagc 60
           |||||||| |||||||||||||| || || |||||||| ||||| ||||| |||   |||
Sbjct: 28  atgcagatattcgtgaaaaccctaactgggaagaccataacccttgaggtcgagagcagc 87

                                                                       
Query: 61  gacaccatcgacaacgtcaaagcgaagatccaggacaaagaagggattccaccggaccag 120
           |||||||| ||||| |||||||| ||||| || ||||||||||| ||||||||||| |||
Sbjct: 88  gacaccattgacaatgtcaaagctaagattcaagacaaagaaggcattccaccggatcag 147

                                                                       
Query: 121 cagaggttgatcttcgccgggaagcagcttgaggatggccgtaccctcgccgattacaac 180
           ||| | |||||||||||||| |||||||| || ||||| || ||||| || |||||||||
Sbjct: 148 cagcgtttgatcttcgccggaaagcagctggaagatgggcgaaccctagcggattacaac 207

                                                                       
Query: 181 atccagaaagagtcaaccttgcatcttgttttgaggcttcgtggtggcattattgagcca 240
           |||||||| || |||||  | ||||||||  | |||||||| ||||| || ||||| || 
Sbjct: 208 atccagaaggaatcaactcttcatcttgtcctcaggcttcgcggtggtatcattgaacct 267

                                                                       
Query: 241 tctctgatggcattggccaggaagtataaccaggacaagatgatctgccgcaagtgttat 300
           ||  |||||||  | ||  | || || || || ||||||||||| |||||||| || |||
Sbjct: 268 tcattgatggctcttgctcgcaaatacaatcaagacaagatgatttgccgcaaatgctat 327

                                                                       
Query: 301 gcacgtctgcatccccgtgctgtcaactgcaggaaaaagaagtgtggacacagcaaccag 360
           || ||| | |||||  | || || |||||| | |||||||||||||| || || || |||
Sbjct: 328 gctcgtttacatccgagagccgtgaactgccgcaaaaagaagtgtggtcatagtaatcag 387

                                       
Query: 361 ttgaggccgaagaagaagatcaagtaaa 388
           |||||||| |||||||||||||||||||
Sbjct: 388 ttgaggccaaagaagaagatcaagtaaa 415


>gnl|LJGI|BW623364 homologue to UniRef100_A1CKM6 Cluster: Ubiquitin; n=2;
           Aspergillus|Rep: Ubiquitin - Aspergillus clavatus,
           partial (50%)
          Length = 332

 Score =  218 bits (110), Expect = 2e-56
 Identities = 176/198 (88%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgcagatcttcgtgaaaaccctgaccggcaagaccatcaccctcgaggtggagtcaagc 60
           ||||||||||||||||| ||||| ||||| ||||||||||| |||||||| |||     |
Sbjct: 105 atgcagatcttcgtgaagaccctcaccggaaagaccatcactctcgaggtcgagagctcc 164

                                                                       
Query: 61  gacaccatcgacaacgtcaaagcgaagatccaggacaaagaagggattccaccggaccag 120
           ||||||||||||||||| || || ||||||||||| || || |||||||| || ||||||
Sbjct: 165 gacaccatcgacaacgttaaggcaaagatccaggataaggaggggattcccccagaccag 224

                                                                       
Query: 121 cagaggttgatcttcgccgggaagcagcttgaggatggccgtaccctcgccgattacaac 180
           |||||||||||||||||||| ||||||||||||||||| |||||||||||||| ||||||
Sbjct: 225 cagaggttgatcttcgccggaaagcagcttgaggatggtcgtaccctcgccgactacaac 284

                             
Query: 181 atccagaaagagtcaacc 198
           |||||||| |||||||||
Sbjct: 285 atccagaaggagtcaacc 302


>gnl|LJGI|TC79823 UniRef100_A1X1E5 Cluster: Polyubiquitin; n=1; Thlaspi
           caerulescens|Rep: Polyubiquitin - Thlaspi caerulescens
           (Alpine penny-cress) (Thlaspi calaminare), partial (38%)
          Length = 507

 Score =  218 bits (110), Expect = 2e-56
 Identities = 173/194 (89%)
 Strand = Plus / Plus

                                                                       
Query: 5   agatcttcgtgaaaaccctgaccggcaagaccatcaccctcgaggtggagtcaagcgaca 64
           ||||||||||||| ||||| ||||| ||||||||||| |||||||| |||     |||||
Sbjct: 70  agatcttcgtgaagaccctcaccggaaagaccatcactctcgaggtcgagagctccgaca 129

                                                                       
Query: 65  ccatcgacaacgtcaaagcgaagatccaggacaaagaagggattccaccggaccagcaga 124
           ||||||||||||| || || ||||||||||| || || |||||||| |||||||||||||
Sbjct: 130 ccatcgacaacgttaaggcaaagatccaggataaggaggggattcccccggaccagcaga 189

                                                                       
Query: 125 ggttgatcttcgccgggaagcagcttgaggatggccgtaccctcgccgattacaacatcc 184
           |||||||||||||||| ||||||||||||||||| |||||||||||||| ||||||||||
Sbjct: 190 ggttgatcttcgccggaaagcagcttgaggatggtcgtaccctcgccgactacaacatcc 249

                         
Query: 185 agaaagagtcaacc 198
           |||| |||||||||
Sbjct: 250 agaaggagtcaacc 263



 Score =  168 bits (85), Expect = 2e-41
 Identities = 170/197 (86%), Gaps = 6/197 (3%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgcagatcttcgtgaaaaccctgaccggcaagaccatcaccctcgaggtggagtcaagc 60
           ||||||||||||||||| ||||| || ||||||||||||||||||||||| ||   ||||
Sbjct: 294 atgcagatcttcgtgaagaccctcactggcaagaccatcaccctcgaggtcga---aagc 350

                                                                       
Query: 61  ---gacaccatcgacaacgtcaaagcgaagatccaggacaaagaagggattccaccggac 117
              ||||| || ||||||||||| || |||||||||||||| || || ||||| ||||| 
Sbjct: 351 tctgacactattgacaacgtcaaggctaagatccaggacaaggagggaattcccccggat 410

                                                                       
Query: 118 cagcagaggttgatcttcgccgggaagcagcttgaggatggccgtaccctcgccgattac 177
           ||||||||||||||||||||||| |||||||| |||||||| || ||| | ||||| |||
Sbjct: 411 cagcagaggttgatcttcgccggcaagcagctcgaggatggtcgcaccttggccgactac 470

                            
Query: 178 aacatccagaaagagtc 194
           ||||||||||| |||||
Sbjct: 471 aacatccagaaggagtc 487


>gnl|LJGI|TC82572 homologue to UniRef100_A1X1E5 Cluster: Polyubiquitin; n=1; Thlaspi
           caerulescens|Rep: Polyubiquitin - Thlaspi caerulescens
           (Alpine penny-cress) (Thlaspi calaminare), partial (44%)
          Length = 717

 Score =  210 bits (106), Expect = 5e-54
 Identities = 175/198 (88%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgcagatcttcgtgaaaaccctgaccggcaagaccatcaccctcgaggtggagtcaagc 60
           ||||||||||||||||| ||||   |||| ||||||||||| |||||||| |||     |
Sbjct: 59  atgcagatcttcgtgaagaccccctccggaaagaccatcactctcgaggtcgagagctcc 118

                                                                       
Query: 61  gacaccatcgacaacgtcaaagcgaagatccaggacaaagaagggattccaccggaccag 120
           ||||||||||||||||| || || ||||||||||| || || |||||||| |||||||||
Sbjct: 119 gacaccatcgacaacgttaaggcaaagatccaggataaggaggggattcccccggaccag 178

                                                                       
Query: 121 cagaggttgatcttcgccgggaagcagcttgaggatggccgtaccctcgccgattacaac 180
           |||||||||||||||||||| ||||||||||||||||| |||||||||||||| ||||||
Sbjct: 179 cagaggttgatcttcgccggaaagcagcttgaggatggtcgtaccctcgccgactacaac 238

                             
Query: 181 atccagaaagagtcaacc 198
           |||||||| |||||||||
Sbjct: 239 atccagaaggagtcaacc 256



 Score =  168 bits (85), Expect = 2e-41
 Identities = 170/197 (86%), Gaps = 6/197 (3%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgcagatcttcgtgaaaaccctgaccggcaagaccatcaccctcgaggtggagtcaagc 60
           ||||||||||||||||| ||||| || ||||||||||||||||||||||| ||   ||||
Sbjct: 287 atgcagatcttcgtgaagaccctcactggcaagaccatcaccctcgaggtcga---aagc 343

                                                                       
Query: 61  ---gacaccatcgacaacgtcaaagcgaagatccaggacaaagaagggattccaccggac 117
              ||||| || ||||||||||| || |||||||||||||| || || ||||| ||||| 
Sbjct: 344 tctgacactattgacaacgtcaaggctaagatccaggacaaggagggaattcccccggat 403

                                                                       
Query: 118 cagcagaggttgatcttcgccgggaagcagcttgaggatggccgtaccctcgccgattac 177
           ||||||||||||||||||||||| |||||||| |||||||| || ||| | ||||| |||
Sbjct: 404 cagcagaggttgatcttcgccggcaagcagctcgaggatggtcgcaccttggccgactac 463

                            
Query: 178 aacatccagaaagagtc 194
           ||||||||||| |||||
Sbjct: 464 aacatccagaaggagtc 480


>gnl|LJGI|BW629347 UniRef100_A1X1E5 Cluster: Polyubiquitin; n=1; Thlaspi
           caerulescens|Rep: Polyubiquitin - Thlaspi caerulescens
           (Alpine penny-cress) (Thlaspi calaminare), partial (39%)
          Length = 532

 Score =  202 bits (102), Expect = 1e-51
 Identities = 174/198 (87%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgcagatcttcgtgaaaaccctgaccggcaagaccatcaccctcgaggtggagtcaagc 60
           ||||||||||||||||| ||||| ||||| ||||||||||| |||   || |||     |
Sbjct: 88  atgcagatcttcgtgaagaccctcaccggaaagaccatcactctctttgtcgagagctcc 147

                                                                       
Query: 61  gacaccatcgacaacgtcaaagcgaagatccaggacaaagaagggattccaccggaccag 120
           ||||||||||||||||| || || ||||||||||| || || |||||||| |||||||||
Sbjct: 148 gacaccatcgacaacgttaaggcaaagatccaggataaggaggggattcccccggaccag 207

                                                                       
Query: 121 cagaggttgatcttcgccgggaagcagcttgaggatggccgtaccctcgccgattacaac 180
           |||||||||||||||||||| ||||||||||||||||| |||||||||||||| ||||||
Sbjct: 208 cagaggttgatcttcgccggaaagcagcttgaggatggtcgtaccctcgccgactacaac 267

                             
Query: 181 atccagaaagagtcaacc 198
           |||||||| |||||||||
Sbjct: 268 atccagaaggagtcaacc 285



 Score =  168 bits (85), Expect = 2e-41
 Identities = 170/197 (86%), Gaps = 6/197 (3%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgcagatcttcgtgaaaaccctgaccggcaagaccatcaccctcgaggtggagtcaagc 60
           ||||||||||||||||| ||||| || ||||||||||||||||||||||| ||   ||||
Sbjct: 316 atgcagatcttcgtgaagaccctcactggcaagaccatcaccctcgaggtcga---aagc 372

                                                                       
Query: 61  ---gacaccatcgacaacgtcaaagcgaagatccaggacaaagaagggattccaccggac 117
              ||||| || ||||||||||| || |||||||||||||| || || ||||| ||||| 
Sbjct: 373 tctgacactattgacaacgtcaaggctaagatccaggacaaggagggaattcccccggat 432

                                                                       
Query: 118 cagcagaggttgatcttcgccgggaagcagcttgaggatggccgtaccctcgccgattac 177
           ||||||||||||||||||||||| |||||||| |||||||| || ||| | ||||| |||
Sbjct: 433 cagcagaggttgatcttcgccggcaagcagctcgaggatggtcgcaccttggccgactac 492

                            
Query: 178 aacatccagaaagagtc 194
           ||||||||||| |||||
Sbjct: 493 aacatccagaaggagtc 509


>gnl|LJGI|TC64176 homologue to UniRef100_A0MKC8 Cluster: Ubiquitin extension protein;
           n=2; core eudicotyledons|Rep: Ubiquitin extension
           protein - Capsicum annuum (Bell pepper), partial (85%)
          Length = 685

 Score =  202 bits (102), Expect = 1e-51
 Identities = 171/194 (88%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgcagatcttcgtgaaaaccctgaccggcaagaccatcaccctcgaggtggagtcaagc 60
           ||||||||||||||||||||||| || || ||||| ||||||||||||||||||||   |
Sbjct: 43  atgcagatcttcgtgaaaaccctaacggggaagacgatcaccctcgaggtggagtcttcc 102

                                                                       
Query: 61  gacaccatcgacaacgtcaaagcgaagatccaggacaaagaagggattccaccggaccag 120
           ||||| |||||||| || ||||| |||||||||||||| || || ||||| |||||||||
Sbjct: 103 gacacaatcgacaatgtgaaagccaagatccaggacaaggagggaattcccccggaccag 162

                                                                       
Query: 121 cagaggttgatcttcgccgggaagcagcttgaggatggccgtaccctcgccgattacaac 180
           |||||||||||||||||||| ||||| || || || ||||| ||||||||||| ||||||
Sbjct: 163 cagaggttgatcttcgccggaaagcaactcgaagacggccgcaccctcgccgactacaac 222

                         
Query: 181 atccagaaagagtc 194
           |||||||| |||||
Sbjct: 223 atccagaaggagtc 236


>gnl|LJGI|TC79910 UniRef100_A1X1E5 Cluster: Polyubiquitin; n=1; Thlaspi
           caerulescens|Rep: Polyubiquitin - Thlaspi caerulescens
           (Alpine penny-cress) (Thlaspi calaminare), partial (36%)
          Length = 487

 Score =  176 bits (89), Expect = 7e-44
 Identities = 171/197 (86%), Gaps = 6/197 (3%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgcagatcttcgtgaaaaccctgaccggcaagaccatcaccctcgaggtggagtcaagc 60
           ||||||||||||||||| ||||| ||||| |||||||||||||||||||| ||   ||||
Sbjct: 70  atgcagatcttcgtgaagaccctcaccggaaagaccatcaccctcgaggtcga---aagc 126

                                                                       
Query: 61  ---gacaccatcgacaacgtcaaagcgaagatccaggacaaagaagggattccaccggac 117
              ||||| |||||||||||||| || |||||||||||||| || || ||||| ||||| 
Sbjct: 127 tctgacactatcgacaacgtcaaggctaagatccaggacaaggagggaattcccccggat 186

                                                                       
Query: 118 cagcagaggttgatcttcgccgggaagcagcttgaggatggccgtaccctcgccgattac 177
           ||||||||||||||||||||||| |||||||| |||||||| || ||| | ||||| |||
Sbjct: 187 cagcagaggttgatcttcgccggcaagcagctcgaggatggtcgcaccttggccgactac 246

                            
Query: 178 aacatccagaaagagtc 194
           ||||||||||| |||||
Sbjct: 247 aacatccagaaggagtc 263



 Score =  143 bits (72), Expect = 9e-34
 Identities = 159/188 (84%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgcagatcttcgtgaaaaccctgaccggcaagaccatcaccctcgaggtggagtcaagc 60
           |||||||||||||| || ||| |||| ||||||||||||||||| ||||| |||      
Sbjct: 298 atgcagatcttcgtcaagaccttgactggcaagaccatcacccttgaggttgagagctct 357

                                                                       
Query: 61  gacaccatcgacaacgtcaaagcgaagatccaggacaaagaagggattccaccggaccag 120
           |||||||||||||||||||| || |||||||| ||||| || || || || |||||||||
Sbjct: 358 gacaccatcgacaacgtcaaggctaagatccaagacaaggagggaatccccccggaccag 417

                                                                       
Query: 121 cagaggttgatcttcgccgggaagcagcttgaggatggccgtaccctcgccgattacaac 180
           |||||| ||||||| ||||| |||||||| |||||||| || ||||| || || ||||||
Sbjct: 418 cagaggctgatctttgccggcaagcagctcgaggatggtcgcacccttgctgactacaac 477

                   
Query: 181 atccagaa 188
           ||||||||
Sbjct: 478 atccagaa 485


>gnl|LJGI|TC62881 homologue to UniRef100_Q06H21 Cluster: Ubiquitin/ribosomal protein
           S27a; n=1; Arachis hypogaea|Rep: Ubiquitin/ribosomal
           protein S27a - Arachis hypogaea (Peanut), complete
          Length = 717

 Score =  170 bits (86), Expect = 4e-42
 Identities = 167/194 (86%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgcagatcttcgtgaaaaccctgaccggcaagaccatcaccctcgaggtggagtcaagc 60
           ||||||||||||||||||||||| || || ||||| |||||||||||||||||||||  |
Sbjct: 81  atgcagatcttcgtgaaaaccctaacggggaagacgatcaccctcgaggtggagtcatcc 140

                                                                       
Query: 61  gacaccatcgacaacgtcaaagcgaagatccaggacaaagaagggattccaccggaccag 120
           ||||| |||||||||||||| || |||||||| ||||| || || || ||||||||||||
Sbjct: 141 gacacaatcgacaacgtcaaggccaagatccaagacaaggagggaatcccaccggaccag 200

                                                                       
Query: 121 cagaggttgatcttcgccgggaagcagcttgaggatggccgtaccctcgccgattacaac 180
           ||| |  | |||||||||||||||||||| || || ||||| || || || || ||||||
Sbjct: 201 cagcgtctcatcttcgccgggaagcagctggaagacggccgcacacttgctgactacaac 260

                         
Query: 181 atccagaaagagtc 194
           |||||||| |||||
Sbjct: 261 atccagaaggagtc 274


>gnl|LJGI|TC76922 homologue to UniRef100_A7QD64 Cluster: Chromosome undetermined
           scaffold_80, whole genome shotgun sequence; n=1; Vitis
           vinifera|Rep: Chromosome undetermined scaffold_80, whole
           genome shotgun sequence - Vitis vinifera (Grape),
           partial (98%)
          Length = 879

 Score =  139 bits (70), Expect = 1e-32
 Identities = 154/182 (84%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgcagatcttcgtgaaaaccctgaccggcaagaccatcaccctcgaggtggagtcaagc 60
           ||||||||||| ||||| ||  |||| || |||||||||||||||||||| |||   |||
Sbjct: 167 atgcagatctttgtgaagactttgactggaaagaccatcaccctcgaggttgagagcagc 226

                                                                       
Query: 61  gacaccatcgacaacgtcaaagcgaagatccaggacaaagaagggattccaccggaccag 120
           |||||||||||||||||||| || |||||||||||||| ||||| || || ||||| |||
Sbjct: 227 gacaccatcgacaacgtcaaggccaagatccaggacaaggaaggcatccctccggatcag 286

                                                                       
Query: 121 cagaggttgatcttcgccgggaagcagcttgaggatggccgtaccctcgccgattacaac 180
           || |||||||| || ||||| |||||||| || |||||||| || || || ||||| |||
Sbjct: 287 caaaggttgatttttgccggtaagcagctggaagatggccgcactcttgctgattataac 346

             
Query: 181 at 182
           ||
Sbjct: 347 at 348


>gnl|LJGI|AV407232 UniRef100_A0MKC8 Cluster: Ubiquitin extension protein; n=2; core
           eudicotyledons|Rep: Ubiquitin extension protein -
           Capsicum annuum (Bell pepper), partial (42%)
          Length = 361

 Score =  123 bits (62), Expect = 9e-28
 Identities = 164/198 (82%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgcagatcttcgtgaaaaccctgaccggcaagaccatcaccctcgaggtggagtcaagc 60
           ||||| ||||||||||||||||| ||||| ||||| ||||| |||||||| |||      
Sbjct: 135 atgcaaatcttcgtgaaaaccctaaccgggaagacaatcactctcgaggtagagagttca 194

                                                                       
Query: 61  gacaccatcgacaacgtcaaagcgaagatccaggacaaagaagggattccaccggaccag 120
           || ||||| |||||||| ||||| |||||||| ||||| |||||||| ||||| || |||
Sbjct: 195 gataccattgacaacgtgaaagctaagatccaagacaaggaagggatcccacctgatcag 254

                                                                       
Query: 121 cagaggttgatcttcgccgggaagcagcttgaggatggccgtaccctcgccgattacaac 180
           || ||||||||||| || ||||||||  | |||||||| || ||||| || || ||||||
Sbjct: 255 caaaggttgatctttgctgggaagcaattggaggatggtcgcacccttgcagactacaac 314

                             
Query: 181 atccagaaagagtcaacc 198
           ||||| || |||||||||
Sbjct: 315 atccaaaaggagtcaacc 332


>gnl|LJGI|TC78962 UniRef100_Q42397 Cluster: Hexaubiquitin protein; n=1; Helianthus
           annuus|Rep: Hexaubiquitin protein - Helianthus annuus
           (Common sunflower), complete
          Length = 1704

 Score =  123 bits (62), Expect = 9e-28
 Identities = 164/198 (82%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgcagatcttcgtgaaaaccctgaccggcaagaccatcaccctcgaggtggagtcaagc 60
           ||||| ||||||||||||||||| ||||| ||||| ||||| |||||||| |||      
Sbjct: 97  atgcaaatcttcgtgaaaaccctaaccgggaagacaatcactctcgaggtagagagttca 156

                                                                       
Query: 61  gacaccatcgacaacgtcaaagcgaagatccaggacaaagaagggattccaccggaccag 120
           || ||||| |||||||| ||||| |||||||| ||||| |||||||| ||||| || |||
Sbjct: 157 gataccattgacaacgtgaaagctaagatccaagacaaggaagggatcccacctgatcag 216

                                                                       
Query: 121 cagaggttgatcttcgccgggaagcagcttgaggatggccgtaccctcgccgattacaac 180
           || ||||||||||| || ||||||||  | |||||||| || ||||| || || ||||||
Sbjct: 217 caaaggttgatctttgctgggaagcaattggaggatggtcgcacccttgcagactacaac 276

                             
Query: 181 atccagaaagagtcaacc 198
           ||||| || |||||||||
Sbjct: 277 atccaaaaggagtcaacc 294



 Score =  119 bits (60), Expect = 1e-26
 Identities = 156/188 (82%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgcagatcttcgtgaaaaccctgaccggcaagaccatcaccctcgaggtggagtcaagc 60
           ||||||||||| || || ||| |||| || || || |||||||||||||| || ||    
Sbjct: 325 atgcagatctttgtcaagaccttgacagggaaaacaatcaccctcgaggttgaatcctca 384

                                                                       
Query: 61  gacaccatcgacaacgtcaaagcgaagatccaggacaaagaagggattccaccggaccag 120
           ||||| ||||| || ||||| ||||||||||| |||||||| || ||||| ||||| |||
Sbjct: 385 gacactatcgataatgtcaaggcgaagatccaagacaaagagggtattcctccggatcag 444

                                                                       
Query: 121 cagaggttgatcttcgccgggaagcagcttgaggatggccgtaccctcgccgattacaac 180
           || |||||||| || || ||||||||||| ||||||||  | |||||||| |||||||||
Sbjct: 445 caaaggttgatttttgctgggaagcagctggaggatggaaggaccctcgctgattacaac 504

                   
Query: 181 atccagaa 188
           ||||||||
Sbjct: 505 atccagaa 512



 Score = 69.9 bits (35), Expect = 1e-11
 Identities = 98/119 (82%)
 Strand = Plus / Plus

                                                                       
Query: 85  aagatccaggacaaagaagggattccaccggaccagcagaggttgatcttcgccgggaag 144
           ||||| |||||||| || || || || ||||||||||||||| | |||||||| ||||| 
Sbjct: 637 aagattcaggacaaggagggcatccctccggaccagcagaggctcatcttcgctgggaaa 696

                                                                      
Query: 145 cagcttgaggatggccgtaccctcgccgattacaacatccagaaagagtcaaccttgca 203
           || |||||||||||  | ||||| || || || ||||||||||| ||||| ||| ||||
Sbjct: 697 caacttgaggatggaaggacccttgctgactataacatccagaaggagtctaccctgca 755



 Score = 69.9 bits (35), Expect = 1e-11
 Identities = 119/147 (80%)
 Strand = Plus / Plus

                                                                        
Query: 82   gcgaagatccaggacaaagaagggattccaccggaccagcagaggttgatcttcgccggg 141
            ||||||||||| ||||| || || ||||| || |||||||||||  |||| || || || 
Sbjct: 1318 gcgaagatccaagacaaggagggtattcctccagaccagcagagactgatttttgctggc 1377

                                                                        
Query: 142  aagcagcttgaggatggccgtaccctcgccgattacaacatccagaaagagtcaaccttg 201
            |||||| | |||||||| ||||| || || ||||| || || ||||| ||||| ||| ||
Sbjct: 1378 aagcagttggaggatggacgtactctggctgattataatattcagaaggagtccaccctg 1437

                                       
Query: 202  catcttgttttgaggcttcgtggtggc 228
            ||||||||  || | ||||||||||||
Sbjct: 1438 catcttgtcctgcgccttcgtggtggc 1464



 Score = 60.0 bits (30), Expect = 1e-08
 Identities = 126/158 (79%)
 Strand = Plus / Plus

                                                                        
Query: 70   gacaacgtcaaagcgaagatccaggacaaagaagggattccaccggaccagcagaggttg 129
            ||||| || ||||| ||||| ||||| || ||||| || || ||||| ||||||||| | 
Sbjct: 1078 gacaatgtgaaagctaagattcaggataaggaaggtatccctccggatcagcagaggctt 1137

                                                                        
Query: 130  atcttcgccgggaagcagcttgaggatggccgtaccctcgccgattacaacatccagaaa 189
            ||||| || ||||||||| | || |||||  | ||||| || ||||| || |||||||| 
Sbjct: 1138 atctttgctgggaagcagttggaagatggaagaacccttgcagattataatatccagaag 1197

                                                  
Query: 190  gagtcaaccttgcatcttgttttgaggcttcgtggtgg 227
            ||||| ||  ||||  | |||||| |||||||||||||
Sbjct: 1198 gagtctacactgcacttggttttgcggcttcgtggtgg 1235


>gnl|LJGI|BW623815 UniRef100_A1X1E5 Cluster: Polyubiquitin; n=1; Thlaspi
           caerulescens|Rep: Polyubiquitin - Thlaspi caerulescens
           (Alpine penny-cress) (Thlaspi calaminare), partial (33%)
          Length = 510

 Score =  107 bits (54), Expect = 5e-23
 Identities = 159/194 (81%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgcagatcttcgtgaaaaccctgaccggcaagaccatcaccctcgaggtggagtcaagc 60
           ||||| ||||||||||||||| |||| |||||||||||||||||||||||||||      
Sbjct: 133 atgcaaatcttcgtgaaaaccttgactggcaagaccatcaccctcgaggtggagagttca 192

                                                                       
Query: 61  gacaccatcgacaacgtcaaagcgaagatccaggacaaagaagggattccaccggaccag 120
           || ||||| ||||| || ||||| |||||||| ||||| |||||||| ||||| || |||
Sbjct: 193 gataccattgacaatgttaaagccaagatccaagacaaggaagggatcccacctgatcag 252

                                                                       
Query: 121 cagaggttgatcttcgccgggaagcagcttgaggatggccgtaccctcgccgattacaac 180
           || ||| | ||||| || ||||||||  | |||||||| || ||| | || || ||||||
Sbjct: 253 caaaggcttatctttgctgggaagcaattagaggatggtcgcaccttagcagactacaac 312

                         
Query: 181 atccagaaagagtc 194
           || ||||| |||||
Sbjct: 313 attcagaaggagtc 326



 Score = 54.0 bits (27), Expect = 7e-07
 Identities = 78/95 (82%)
 Strand = Plus / Plus

                                                                       
Query: 37  atcaccctcgaggtggagtcaagcgacaccatcgacaacgtcaaagcgaagatccaggac 96
           ||||||||||||||||| ||    |||||||| || || || || |||||||||||||||
Sbjct: 397 atcaccctcgaggtggaatcctcagacaccattgataatgtgaaggcgaagatccaggac 456

                                              
Query: 97  aaagaagggattccaccggaccagcagaggttgat 131
           ||||| || || ||||| || ||||| ||| ||||
Sbjct: 457 aaagagggcatcccaccagatcagcaaaggctgat 491


>gnl|LJGI|TC77422 UniRef100_Q7EUR6 Cluster: AT4g05320/C17L7_240; n=8; core
           eudicotyledons|Rep: AT4g05320/C17L7_240 - Arabidopsis
           thaliana (Mouse-ear cress), complete
          Length = 1468

 Score =  107 bits (54), Expect = 5e-23
 Identities = 159/194 (81%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgcagatcttcgtgaaaaccctgaccggcaagaccatcaccctcgaggtggagtcaagc 60
           ||||| ||||||||||||||| |||| |||||||||||||||||||||||||||      
Sbjct: 104 atgcaaatcttcgtgaaaaccttgactggcaagaccatcaccctcgaggtggagagttca 163

                                                                       
Query: 61  gacaccatcgacaacgtcaaagcgaagatccaggacaaagaagggattccaccggaccag 120
           || ||||| ||||| || ||||| |||||||| ||||| |||||||| ||||| || |||
Sbjct: 164 gataccattgacaatgttaaagccaagatccaagacaaggaagggatcccacctgatcag 223

                                                                       
Query: 121 cagaggttgatcttcgccgggaagcagcttgaggatggccgtaccctcgccgattacaac 180
           || ||| | ||||| || ||||||||  | |||||||| || ||| | || || ||||||
Sbjct: 224 caaaggcttatctttgctgggaagcaattagaggatggtcgcaccttagcagactacaac 283

                         
Query: 181 atccagaaagagtc 194
           || ||||| |||||
Sbjct: 284 attcagaaggagtc 297



 Score = 91.7 bits (46), Expect = 3e-18
 Identities = 130/158 (82%)
 Strand = Plus / Plus

                                                                       
Query: 37  atcaccctcgaggtggagtcaagcgacaccatcgacaacgtcaaagcgaagatccaggac 96
           ||||||||||||||||| ||    |||||||| || || || || |||||||||||||||
Sbjct: 368 atcaccctcgaggtggaatcctcagacaccattgataatgtgaaggcgaagatccaggac 427

                                                                       
Query: 97  aaagaagggattccaccggaccagcagaggttgatcttcgccgggaagcagcttgaggat 156
           ||||| || || ||||| || ||||| ||| |||| || || || || || || ||||||
Sbjct: 428 aaagagggcatcccaccagatcagcaaaggctgatttttgctggtaaacaactcgaggat 487

                                                 
Query: 157 ggccgtaccctcgccgattacaacatccagaaagagtc 194
           ||  | |||||||||||||||||||||||||| |||||
Sbjct: 488 ggaaggaccctcgccgattacaacatccagaaggagtc 525



 Score = 89.7 bits (45), Expect = 1e-17
 Identities = 123/149 (82%)
 Strand = Plus / Plus

                                                                        
Query: 79   aaagcgaagatccaggacaaagaagggattccaccggaccagcagaggttgatcttcgcc 138
            ||||| ||||| ||||| || || || |||||||| |||||||||||| | ||||| || 
Sbjct: 866  aaagctaagattcaggataaggagggtattccaccagaccagcagaggcttatctttgct 925

                                                                        
Query: 139  gggaagcagcttgaggatggccgtaccctcgccgattacaacatccagaaagagtcaacc 198
            ||||||||||| || |||||  | ||||| || |||||||| |||||||| ||||| |||
Sbjct: 926  gggaagcagctggaagatggtaggaccctggctgattacaatatccagaaggagtccacc 985

                                         
Query: 199  ttgcatcttgttttgaggcttcgtggtgg 227
             ||||  | |||||| |||||||||||||
Sbjct: 986  ctgcacttggttttgcggcttcgtggtgg 1014



 Score = 73.8 bits (37), Expect = 7e-13
 Identities = 94/113 (83%)
 Strand = Plus / Plus

                                                                       
Query: 82  gcgaagatccaggacaaagaagggattccaccggaccagcagaggttgatcttcgccggg 141
           |||||||| |||||||| || || || || || |||||||||||| | ||||| || |||
Sbjct: 641 gcgaagattcaggacaaggagggcatccctccagaccagcagaggctcatctttgctggg 700

                                                                
Query: 142 aagcagcttgaggatggccgtaccctcgccgattacaacatccagaaagagtc 194
           ||||||||||| |||||  | ||||| || ||||| ||||||||||| |||||
Sbjct: 701 aagcagcttgaagatggaagaacccttgctgattataacatccagaaggagtc 753



 Score = 61.9 bits (31), Expect = 3e-09
 Identities = 118/147 (80%)
 Strand = Plus / Plus

                                                                        
Query: 82   gcgaagatccaggacaaagaagggattccaccggaccagcagaggttgatcttcgccggg 141
            |||||||| ||||||||||| || ||||| || ||||||||| |  |||| || || || 
Sbjct: 1097 gcgaagattcaggacaaagagggtattcctccagaccagcagcgactgatttttgctggc 1156

                                                                        
Query: 142  aagcagcttgaggatggccgtaccctcgccgattacaacatccagaaagagtcaaccttg 201
            |||||| | |||||||| || ||  | || ||||| || |||||||| ||||| ||| ||
Sbjct: 1157 aagcagttggaggatggtcgaactttggcagattataatatccagaaggagtccaccctg 1216

                                       
Query: 202  catcttgttttgaggcttcgtggtggc 228
            ||||||||  || | ||||||||||||
Sbjct: 1217 catcttgtcctgcgccttcgtggtggc 1243


>gnl|LJGI|TC71652 UniRef100_A1X1E5 Cluster: Polyubiquitin; n=1; Thlaspi
           caerulescens|Rep: Polyubiquitin - Thlaspi caerulescens
           (Alpine penny-cress) (Thlaspi calaminare), partial (56%)
          Length = 725

 Score =  107 bits (54), Expect = 5e-23
 Identities = 159/194 (81%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgcagatcttcgtgaaaaccctgaccggcaagaccatcaccctcgaggtggagtcaagc 60
           ||||||||||| || || ||  |||| || || ||||||||||| ||||| |||||    
Sbjct: 313 atgcagatctttgttaagactttgactgggaaaaccatcacccttgaggttgagtcctcg 372

                                                                       
Query: 61  gacaccatcgacaacgtcaaagcgaagatccaggacaaagaagggattccaccggaccag 120
           |||||||| ||||| ||||| |||||||||||||| ||||| || || || || || |||
Sbjct: 373 gacaccattgacaatgtcaaggcgaagatccaggataaagagggcatccctccagatcag 432

                                                                       
Query: 121 cagaggttgatcttcgccgggaagcagcttgaggatggccgtaccctcgccgattacaac 180
           ||||||||||| || || ||||| || |||||||||||  | ||||| || |||||||||
Sbjct: 433 cagaggttgatttttgctgggaaacaacttgaggatggaaggaccctagctgattacaac 492

                         
Query: 181 atccagaaagagtc 194
           |||||||| |||||
Sbjct: 493 atccagaaggagtc 506



 Score = 95.6 bits (48), Expect = 2e-19
 Identities = 126/152 (82%)
 Strand = Plus / Plus

                                                                       
Query: 34  accatcaccctcgaggtggagtcaagcgacaccatcgacaacgtcaaagcgaagatccag 93
           ||||||||||||||||| || ||    |||||||| ||||| ||||| ||||||||||||
Sbjct: 574 accatcaccctcgaggttgaatcctcggacaccattgacaatgtcaaggcgaagatccag 633

                                                                       
Query: 94  gacaaagaagggattccaccggaccagcagaggttgatcttcgccgggaagcagcttgag 153
           || ||||| || || || || |||||||||||| | || || |||||||| |||||||||
Sbjct: 634 gataaagagggcatccctccagaccagcagaggcttatttttgccgggaaacagcttgag 693

                                           
Query: 154 gatggccgtaccctcgccgattacaacatcca 185
           |||||  | ||||| || |||||||| |||||
Sbjct: 694 gatggaaggaccctagctgattacaatatcca 725



 Score = 75.8 bits (38), Expect = 2e-13
 Identities = 146/182 (80%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgcagatcttcgtgaaaaccctgaccggcaagaccatcaccctcgaggtggagtcaagc 60
           |||||||| || |||||||| || |||||||||||||| ||||| ||||||||       
Sbjct: 85  atgcagatttttgtgaaaactctcaccggcaagaccattacccttgaggtggaaagttca 144

                                                                       
Query: 61  gacaccatcgacaacgtcaaagcgaagatccaggacaaagaagggattccaccggaccag 120
           || ||||| ||||| || |||||||| ||||| ||||| |||||||| ||||| || |||
Sbjct: 145 gataccattgacaatgttaaagcgaaaatccaagacaaggaagggatcccacctgatcag 204

                                                                       
Query: 121 cagaggttgatcttcgccgggaagcagcttgaggatggccgtaccctcgccgattacaac 180
           || ||| | ||||| || || |||||  | |||||||| || ||||| || |||||||||
Sbjct: 205 caaaggcttatctttgctggtaagcaattggaggatggtcgcacccttgctgattacaac 264

             
Query: 181 at 182
           ||
Sbjct: 265 at 266


>gnl|LJGI|TC67537 UniRef100_Q7EUR6 Cluster: AT4g05320/C17L7_240; n=8; core
           eudicotyledons|Rep: AT4g05320/C17L7_240 - Arabidopsis
           thaliana (Mouse-ear cress), partial (80%)
          Length = 1160

 Score =  107 bits (54), Expect = 5e-23
 Identities = 159/194 (81%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgcagatcttcgtgaaaaccctgaccggcaagaccatcaccctcgaggtggagtcaagc 60
           ||||||||||| |||||||| ||||||||||||||||||||| | |||||||||      
Sbjct: 86  atgcagatctttgtgaaaactctgaccggcaagaccatcaccttagaggtggagagttca 145

                                                                       
Query: 61  gacaccatcgacaacgtcaaagcgaagatccaggacaaagaagggattccaccggaccag 120
           || ||||| || || || ||||| ||||||||||| || |||||||| ||||| || |||
Sbjct: 146 gataccattgataatgtaaaagccaagatccaggataaggaagggatcccacctgatcag 205

                                                                       
Query: 121 cagaggttgatcttcgccgggaagcagcttgaggatggccgtaccctcgccgattacaac 180
           || ||| | ||||| || || |||||| | |||||||| || ||||| || || ||||||
Sbjct: 206 caaaggcttatctttgctggcaagcagttagaggatggtcgcacccttgctgactacaac 265

                         
Query: 181 atccagaaagagtc 194
           |||||||| |||||
Sbjct: 266 atccagaaggagtc 279



 Score = 99.6 bits (50), Expect = 1e-20
 Identities = 158/194 (81%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgcagatcttcgtgaaaaccctgaccggcaagaccatcaccctcgaggtggagtcaagc 60
           ||||||||||| || || ||| |||| || || ||||||||||||||||| || ||    
Sbjct: 314 atgcagatctttgtcaagaccttgacagggaaaaccatcaccctcgaggtcgaatcctca 373

                                                                       
Query: 61  gacaccatcgacaacgtcaaagcgaagatccaggacaaagaagggattccaccggaccag 120
           |||||||| || || ||||| || ||||||||||||||||| || || ||||| ||||||
Sbjct: 374 gacaccattgataatgtcaaggccaagatccaggacaaagagggtataccacccgaccag 433

                                                                       
Query: 121 cagaggttgatcttcgccgggaagcagcttgaggatggccgtaccctcgccgattacaac 180
           |||||| | || || || ||||| || |||||||||||  | ||| | || |||||||||
Sbjct: 434 cagaggcttatttttgctgggaaacaacttgaggatgggaggaccttggctgattacaac 493

                         
Query: 181 atccagaaagagtc 194
           |||||||| |||||
Sbjct: 494 atccagaaggagtc 507



 Score = 56.0 bits (28), Expect = 2e-07
 Identities = 121/152 (79%)
 Strand = Plus / Plus

                                                                       
Query: 79  aaagcgaagatccaggacaaagaagggattccaccggaccagcagaggttgatcttcgcc 138
           ||||| ||||| |||||||| || || || || || |||||||||||| | ||||| || 
Sbjct: 620 aaagccaagattcaggacaaggagggcatcccgccagaccagcagaggctcatctttgct 679

                                                                       
Query: 139 gggaagcagcttgaggatggccgtaccctcgccgattacaacatccagaaagagtcaacc 198
           || || |||||||| |||||  | ||||| || ||||| ||||| ||||| ||||| || 
Sbjct: 680 ggaaaacagcttgaagatggaagaacccttgctgattataacattcagaaggagtctact 739

                                           
Query: 199 ttgcatcttgttttgaggcttcgtggtggcat 230
            ||||| | || ||| |||||||||| |||||
Sbjct: 740 ctgcatttggtgttgcggcttcgtggaggcat 771


>gnl|LJGI|BW626875 homologue to UniRef100_A1X1E5 Cluster: Polyubiquitin; n=1; Thlaspi
           caerulescens|Rep: Polyubiquitin - Thlaspi caerulescens
           (Alpine penny-cress) (Thlaspi calaminare), partial (31%)
          Length = 486

 Score = 99.6 bits (50), Expect = 1e-20
 Identities = 122/146 (83%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgcagatcttcgtgaaaaccctgaccggcaagaccatcaccctcgaggtggagtcaagc 60
           ||||| ||||||||||||||| |||| |||||||||||||||||||||||||||      
Sbjct: 128 atgcaaatcttcgtgaaaaccttgactggcaagaccatcaccctcgaggtggagagttca 187

                                                                       
Query: 61  gacaccatcgacaacgtcaaagcgaagatccaggacaaagaagggattccaccggaccag 120
           || ||||| ||||| || ||||| |||||||| ||||| |||||||| ||||| || |||
Sbjct: 188 gataccattgacaatgttaaagccaagatccaagacaaggaagggatcccacctgatcag 247

                                     
Query: 121 cagaggttgatcttcgccgggaagca 146
           || ||| | ||||| || ||||||||
Sbjct: 248 caaaggcttatctttgctgggaagca 273



 Score = 54.0 bits (27), Expect = 7e-07
 Identities = 78/95 (82%)
 Strand = Plus / Plus

                                                                       
Query: 37  atcaccctcgaggtggagtcaagcgacaccatcgacaacgtcaaagcgaagatccaggac 96
           ||||||||||||||||| ||    |||||||| || || || || |||||||||||||||
Sbjct: 392 atcaccctcgaggtggaatcctcagacaccattgataatgtgaaggcgaagatccaggac 451

                                              
Query: 97  aaagaagggattccaccggaccagcagaggttgat 131
           ||||| || || ||||| || ||||| ||| ||||
Sbjct: 452 aaagagggcatcccaccagatcagcaaaggctgat 486


>gnl|LJGI|TC60580 UniRef100_Q42397 Cluster: Hexaubiquitin protein; n=1; Helianthus
            annuus|Rep: Hexaubiquitin protein - Helianthus annuus
            (Common sunflower), complete
          Length = 1623

 Score = 99.6 bits (50), Expect = 1e-20
 Identities = 158/194 (81%)
 Strand = Plus / Plus

                                                                        
Query: 1    atgcagatcttcgtgaaaaccctgaccggcaagaccatcaccctcgaggtggagtcaagc 60
            ||||| ||||| || || ||||| || || |||||||||||||| |||||||||      
Sbjct: 1244 atgcaaatctttgtcaagaccctcactggaaagaccatcacccttgaggtggagagttct 1303

                                                                        
Query: 61   gacaccatcgacaacgtcaaagcgaagatccaggacaaagaagggattccaccggaccag 120
            ||||||||||||||||| || || || || || ||||||||||| |||||||| ||||| 
Sbjct: 1304 gacaccatcgacaacgtgaaggctaaaattcaagacaaagaaggcattccaccagaccaa 1363

                                                                        
Query: 121  cagaggttgatcttcgccgggaagcagcttgaggatggccgtaccctcgccgattacaac 180
            |||||| | ||||| || || || ||||||||||||||| | ||  | || |||||||||
Sbjct: 1364 cagaggctcatctttgctggcaaacagcttgaggatggcagaactttggctgattacaac 1423

                          
Query: 181  atccagaaagagtc 194
            || |||||||||||
Sbjct: 1424 attcagaaagagtc 1437



 Score = 85.7 bits (43), Expect = 2e-16
 Identities = 181/227 (79%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgcagatcttcgtgaaaaccctgaccggcaagaccatcaccctcgaggtggagtcaagc 60
           ||||||||||| ||||| ||  |||| || |||||||||||||| |||||||||      
Sbjct: 332 atgcagatctttgtgaagacattgactggaaagaccatcacccttgaggtggagagctct 391

                                                                       
Query: 61  gacaccatcgacaacgtcaaagcgaagatccaggacaaagaagggattccaccggaccag 120
           |||||||| ||||| || || || ||||| ||||||||||| || || || || ||||||
Sbjct: 392 gacaccattgacaatgttaaggccaagattcaggacaaagagggcatccctccagaccag 451

                                                                       
Query: 121 cagaggttgatcttcgccgggaagcagcttgaggatggccgtaccctcgccgattacaac 180
           |||||| | || ||||| || || ||||||||||||| | | ||  | || |||||||||
Sbjct: 452 cagaggctcatattcgctggcaaacagcttgaggatgacagaacattggctgattacaac 511

                                                          
Query: 181 atccagaaagagtcaaccttgcatcttgttttgaggcttcgtggtgg 227
           || ||||||||||| ||| | || ||||| ||| | || ||||||||
Sbjct: 512 attcagaaagagtccaccctccaccttgtgttgcgactccgtggtgg 558



 Score = 77.8 bits (39), Expect = 5e-14
 Identities = 81/95 (85%)
 Strand = Plus / Plus

                                                                       
Query: 100 gaagggattccaccggaccagcagaggttgatcttcgccgggaagcagcttgaggatggc 159
           |||||||| ||||||||||||||| |  | || || || || |||||||| |||||||| 
Sbjct: 203 gaagggatcccaccggaccagcagcgtctcatttttgctggcaagcagctggaggatggg 262

                                              
Query: 160 cgtaccctcgccgattacaacatccagaaagagtc 194
           |||||||| || |||||||||||||| ||||||||
Sbjct: 263 cgtacccttgctgattacaacatccaaaaagagtc 297



 Score = 61.9 bits (31), Expect = 3e-09
 Identities = 88/107 (82%)
 Strand = Plus / Plus

                                                                        
Query: 88   atccaggacaaagaagggattccaccggaccagcagaggttgatcttcgccgggaagcag 147
            |||||||| || || || ||||| || |||||||| |||||||| || || || ||||| 
Sbjct: 1103 atccaggataaggagggtattcccccagaccagcaaaggttgatttttgctggaaagcaa 1162

                                                           
Query: 148  cttgaggatggccgtaccctcgccgattacaacatccagaaagagtc 194
            ||||| ||||| ||||| || || || |||||||| |||||||||||
Sbjct: 1163 cttgaagatggacgtactctggctgactacaacattcagaaagagtc 1209



 Score = 60.0 bits (30), Expect = 1e-08
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 148 cttgaggatggccgtaccctcgccgattacaacatccagaaagagtcaac 197
           |||||||||||||| || || || ||||| ||||||||||||||||||||
Sbjct: 935 cttgaggatggccgaactctggcagattataacatccagaaagagtcaac 984



 Score = 58.0 bits (29), Expect = 4e-08
 Identities = 83/101 (82%)
 Strand = Plus / Plus

                                                                       
Query: 94  gacaaagaagggattccaccggaccagcagaggttgatcttcgccgggaagcagcttgag 153
           |||||||| || || ||||| ||||| |||||| | ||||| || || || |||||||| 
Sbjct: 653 gacaaagagggcatcccaccagaccaacagaggctcatctttgctggtaaacagcttgaa 712

                                                    
Query: 154 gatggccgtaccctcgccgattacaacatccagaaagagtc 194
           |||||| | ||| | ||||| |||||||| |||||||||||
Sbjct: 713 gatggcagaaccttggccgactacaacattcagaaagagtc 753


>gnl|LJGI|TC80080 UniRef100_A1X1E5 Cluster: Polyubiquitin; n=1; Thlaspi
           caerulescens|Rep: Polyubiquitin - Thlaspi caerulescens
           (Alpine penny-cress) (Thlaspi calaminare), partial (35%)
          Length = 523

 Score = 83.8 bits (42), Expect = 7e-16
 Identities = 129/158 (81%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgcagatcttcgtgaaaaccctgaccggcaagaccatcaccctcgaggtggagtcaagc 60
           ||||||||||| || || ||  |||| || || ||||||||||| ||||| |||||    
Sbjct: 352 atgcagatctttgttaagactttgactgggaaaaccatcacccttgaggttgagtcctcg 411

                                                                       
Query: 61  gacaccatcgacaacgtcaaagcgaagatccaggacaaagaagggattccaccggaccag 120
           |||||||| ||||| ||||| |||||||||||||| ||||| || || || || || |||
Sbjct: 412 gacaccattgacaatgtcaaggcgaagatccaggataaagagggcatccctccagatcag 471

                                                 
Query: 121 cagaggttgatcttcgccgggaagcagcttgaggatgg 158
           ||||||||||| || || ||||| || |||||||||||
Sbjct: 472 cagaggttgatttttgctgggaaacaacttgaggatgg 509



 Score = 75.8 bits (38), Expect = 2e-13
 Identities = 146/182 (80%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgcagatcttcgtgaaaaccctgaccggcaagaccatcaccctcgaggtggagtcaagc 60
           |||||||| || |||||||| || |||||||||||||| ||||| ||||||||       
Sbjct: 124 atgcagatttttgtgaaaactctcaccggcaagaccattacccttgaggtggaaagttca 183

                                                                       
Query: 61  gacaccatcgacaacgtcaaagcgaagatccaggacaaagaagggattccaccggaccag 120
           || ||||| ||||| || |||||||| ||||| ||||| |||||||| ||||| || |||
Sbjct: 184 gataccattgacaatgttaaagcgaaaatccaagacaaggaagggatcccacctgatcag 243

                                                                       
Query: 121 cagaggttgatcttcgccgggaagcagcttgaggatggccgtaccctcgccgattacaac 180
           || ||| | ||||| || || |||||  | |||||||| || ||||| || |||||||||
Sbjct: 244 caaaggcttatctttgctggtaagcaattggaggatggtcgcacccttgctgattacaac 303

             
Query: 181 at 182
           ||
Sbjct: 304 at 305


>gnl|LJGI|BW623042 UniRef100_A1X1E5 Cluster: Polyubiquitin; n=1; Thlaspi
           caerulescens|Rep: Polyubiquitin - Thlaspi caerulescens
           (Alpine penny-cress) (Thlaspi calaminare), partial (32%)
          Length = 471

 Score = 75.8 bits (38), Expect = 2e-13
 Identities = 146/182 (80%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgcagatcttcgtgaaaaccctgaccggcaagaccatcaccctcgaggtggagtcaagc 60
           |||||||| || |||||||| || |||||||||||||| ||||| ||||||||       
Sbjct: 101 atgcagatttttgtgaaaactctcaccggcaagaccattacccttgaggtggaaagttca 160

                                                                       
Query: 61  gacaccatcgacaacgtcaaagcgaagatccaggacaaagaagggattccaccggaccag 120
           || ||||| ||||| || |||||||| ||||| ||||| |||||||| ||||| || |||
Sbjct: 161 gataccattgacaatgttaaagcgaaaatccaagacaaggaagggatcccacctgatcag 220

                                                                       
Query: 121 cagaggttgatcttcgccgggaagcagcttgaggatggccgtaccctcgccgattacaac 180
           || ||| | ||||| || || |||||  | |||||||| || ||||| || |||||||||
Sbjct: 221 caaaggcttatctttgctggtaagcaattggaggatggtcgcacccttgctgattacaac 280

             
Query: 181 at 182
           ||
Sbjct: 281 at 282



 Score = 69.9 bits (35), Expect = 1e-11
 Identities = 107/131 (81%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgcagatcttcgtgaaaaccctgaccggcaagaccatcaccctcgaggtggagtcaagc 60
           ||||||||||| || || ||  |||| || || ||||||||||| ||||| |||||    
Sbjct: 329 atgcagatctttgttaagactttgactgggaaaaccatcacccttgaggttgagtcctcg 388

                                                                       
Query: 61  gacaccatcgacaacgtcaaagcgaagatccaggacaaagaagggattccaccggaccag 120
           |||||||| ||||| ||||| |||||||||||||| ||||| || || || || || |||
Sbjct: 389 gacaccattgacaatgtcaaggcgaagatccaggataaagagggcatccctccagatcag 448

                      
Query: 121 cagaggttgat 131
           |||||||||||
Sbjct: 449 cagaggttgat 459


>gnl|LJGI|TC81636 UniRef100_A4US66 Cluster: Ubiquitin B; n=2; Coelomata|Rep:
           Ubiquitin B - Sus scrofa (Pig), partial (72%)
          Length = 566

 Score = 73.8 bits (37), Expect = 7e-13
 Identities = 94/113 (83%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgcagatcttcgtgaaaaccctgaccggcaagaccatcaccctcgaggtggagtcaagc 60
           ||||| |||||||| ||||| || || ||||| || ||||| |||||||| ||  |||||
Sbjct: 228 atgcaaatcttcgtcaaaacactcacaggcaaaacaatcacgctcgaggtcgaaccaagc 287

                                                                
Query: 61  gacaccatcgacaacgtcaaagcgaagatccaggacaaagaagggattccacc 113
           ||||| ||||| |||||||||||||| || || || || ||||| ||||||||
Sbjct: 288 gacacgatcgaaaacgtcaaagcgaaaattcaagataaggaaggtattccacc 340


>gnl|LJGI|FS360056 homologue to UniRef100_A3LZJ4 Cluster: Predicted protein; n=7;
           Eukaryota|Rep: Predicted protein - Pichia stipitis
           (Yeast), partial (62%)
          Length = 691

 Score = 71.9 bits (36), Expect = 3e-12
 Identities = 93/111 (83%), Gaps = 2/111 (1%)
 Strand = Plus / Minus

                                                                       
Query: 84  gaagatccaggacaaagaagggattccaccggaccagcagaggttgatcttcgccgggaa 143
           |||||| |||||||| || || |||||||||||||||||| | ||||| || || || ||
Sbjct: 268 gaagattcaggacaaggagggcattccaccggaccagcagcgattgatttttgcaggaaa 209

                                                              
Query: 144 gcagcttgaggatggccgtaccctcgccgattacaacatccagaaagagtc 194
           |||||| |||||||| || ||| |  | ||||||||||| |||||||||||
Sbjct: 208 gcagctggaggatgggcgcacctt--ctgattacaacattcagaaagagtc 160


>gnl|LJGI|TC81524 homologue to UniRef100_A1X1E5 Cluster: Polyubiquitin; n=1; Thlaspi
           caerulescens|Rep: Polyubiquitin - Thlaspi caerulescens
           (Alpine penny-cress) (Thlaspi calaminare), partial (15%)
          Length = 382

 Score = 69.9 bits (35), Expect = 1e-11
 Identities = 47/51 (92%)
 Strand = Plus / Minus

                                                              
Query: 108 tccaccggaccagcagaggttgatcttcgccgggaagcagcttgaggatgg 158
           ||||||||||||||||||||||||||| || ||||||||| | ||||||||
Sbjct: 64  tccaccggaccagcagaggttgatctttgcagggaagcagttggaggatgg 14


>gnl|LJGI|TC81522 homologue to UniRef100_A1X1E5 Cluster: Polyubiquitin; n=1; Thlaspi
           caerulescens|Rep: Polyubiquitin - Thlaspi caerulescens
           (Alpine penny-cress) (Thlaspi calaminare), partial (41%)
          Length = 617

 Score = 69.9 bits (35), Expect = 1e-11
 Identities = 98/119 (82%)
 Strand = Plus / Plus

                                                                       
Query: 85  aagatccaggacaaagaagggattccaccggaccagcagaggttgatcttcgccgggaag 144
           ||||| |||||||| || || || || ||||||||||||||| | |||||||| ||||| 
Sbjct: 311 aagattcaggacaaggagggcatccctccggaccagcagaggctcatcttcgctgggaaa 370

                                                                      
Query: 145 cagcttgaggatggccgtaccctcgccgattacaacatccagaaagagtcaaccttgca 203
           || |||||||||||  | ||||| || || || ||||||||||| ||||| ||| ||||
Sbjct: 371 caacttgaggatggaaggacccttgctgactataacatccagaaggagtctaccctgca 429



 Score = 63.9 bits (32), Expect = 7e-10
 Identities = 86/104 (82%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgcagatcttcgtgaaaaccctgaccggcaagaccatcaccctcgaggtggagtcaagc 60
           ||||| ||||||||||||||||| ||||| ||||| ||||| |||||||| |||      
Sbjct: 85  atgcaaatcttcgtgaaaaccctaaccgggaagacaatcactctcgaggtagagagttca 144

                                                       
Query: 61  gacaccatcgacaacgtcaaagcgaagatccaggacaaagaagg 104
           || |||||  ||||||| ||||| |||||||| |||||||||||
Sbjct: 145 gataccattaacaacgtgaaagctaagatccaagacaaagaagg 188


>gnl|LJGI|AV422262 UniRef100_A0MKC8 Cluster: Ubiquitin extension protein; n=2; core
           eudicotyledons|Rep: Ubiquitin extension protein -
           Capsicum annuum (Bell pepper), partial (17%)
          Length = 148

 Score = 61.9 bits (31), Expect = 3e-09
 Identities = 69/78 (88%), Gaps = 4/78 (5%)
 Strand = Plus / Plus

                                                                       
Query: 85  aagatccaggacaaagaagggattccaccgg-accagcagaggtt--gatcttcgccggg 141
           ||||||||||| || || |||||||| |||| ||||||||||| |  |||||||||||||
Sbjct: 4   aagatccaggataaggaggggattcccccgggaccagcagagggttggatcttcgccggg 63

                             
Query: 142 aa-gcagcttgaggatgg 158
           || |||||||||||||||
Sbjct: 64  aaagcagcttgaggatgg 81