Miyakogusa Predicted Gene
- Lj1g3v1035300.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj1g3v1035300.1 tr|Q45W78|Q45W78_ARAHY Ubiquitin fusion protein
OS=Arachis hypogaea PE=2 SV=1,99.22,0,no description,NULL;
UBIQUITIN_2,Ubiquitin supergroup; UBIQUITIN,NULL; ubiquitin,Ubiquitin;
Ribosoma,CUFF.26717.1
(390 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC64454 UniRef100_Q45W78 Cluster: Ubiquitin fusion prot... 773 0.0
gnl|LJGI|BW604401 UniRef100_A0MKC8 Cluster: Ubiquitin extension ... 226 8e-59
gnl|LJGI|BW629410 UniRef100_A1X1E5 Cluster: Polyubiquitin; n=1; ... 226 8e-59
gnl|LJGI|BW620072 UniRef100_A0MKC8 Cluster: Ubiquitin extension ... 226 8e-59
gnl|LJGI|TC81113 UniRef100_A1X1E5 Cluster: Polyubiquitin; n=1; T... 226 8e-59
gnl|LJGI|TC79728 UniRef100_Q7EUR6 Cluster: AT4g05320/C17L7_240; ... 226 8e-59
gnl|LJGI|TC65553 UniRef100_Q45W78 Cluster: Ubiquitin fusion prot... 226 8e-59
gnl|LJGI|TC66444 UniRef100_Q45W78 Cluster: Ubiquitin fusion prot... 222 1e-57
gnl|LJGI|TC62585 UniRef100_Q45W78 Cluster: Ubiquitin fusion prot... 222 1e-57
gnl|LJGI|BW623364 homologue to UniRef100_A1CKM6 Cluster: Ubiquit... 218 2e-56
gnl|LJGI|TC79823 UniRef100_A1X1E5 Cluster: Polyubiquitin; n=1; T... 218 2e-56
gnl|LJGI|TC82572 homologue to UniRef100_A1X1E5 Cluster: Polyubiq... 210 5e-54
gnl|LJGI|BW629347 UniRef100_A1X1E5 Cluster: Polyubiquitin; n=1; ... 202 1e-51
gnl|LJGI|TC64176 homologue to UniRef100_A0MKC8 Cluster: Ubiquiti... 202 1e-51
gnl|LJGI|TC79910 UniRef100_A1X1E5 Cluster: Polyubiquitin; n=1; T... 176 7e-44
gnl|LJGI|TC62881 homologue to UniRef100_Q06H21 Cluster: Ubiquiti... 170 4e-42
gnl|LJGI|TC76922 homologue to UniRef100_A7QD64 Cluster: Chromoso... 139 1e-32
gnl|LJGI|AV407232 UniRef100_A0MKC8 Cluster: Ubiquitin extension ... 123 9e-28
gnl|LJGI|TC78962 UniRef100_Q42397 Cluster: Hexaubiquitin protein... 123 9e-28
gnl|LJGI|BW623815 UniRef100_A1X1E5 Cluster: Polyubiquitin; n=1; ... 107 5e-23
gnl|LJGI|TC77422 UniRef100_Q7EUR6 Cluster: AT4g05320/C17L7_240; ... 107 5e-23
gnl|LJGI|TC71652 UniRef100_A1X1E5 Cluster: Polyubiquitin; n=1; T... 107 5e-23
gnl|LJGI|TC67537 UniRef100_Q7EUR6 Cluster: AT4g05320/C17L7_240; ... 107 5e-23
gnl|LJGI|BW626875 homologue to UniRef100_A1X1E5 Cluster: Polyubi... 100 1e-20
gnl|LJGI|TC60580 UniRef100_Q42397 Cluster: Hexaubiquitin protein... 100 1e-20
gnl|LJGI|TC80080 UniRef100_A1X1E5 Cluster: Polyubiquitin; n=1; T... 84 7e-16
gnl|LJGI|BW623042 UniRef100_A1X1E5 Cluster: Polyubiquitin; n=1; ... 76 2e-13
gnl|LJGI|TC81636 UniRef100_A4US66 Cluster: Ubiquitin B; n=2; Coe... 74 7e-13
gnl|LJGI|FS360056 homologue to UniRef100_A3LZJ4 Cluster: Predict... 72 3e-12
gnl|LJGI|TC81524 homologue to UniRef100_A1X1E5 Cluster: Polyubiq... 70 1e-11
gnl|LJGI|TC81522 homologue to UniRef100_A1X1E5 Cluster: Polyubiq... 70 1e-11
gnl|LJGI|AV422262 UniRef100_A0MKC8 Cluster: Ubiquitin extension ... 62 3e-09
>gnl|LJGI|TC64454 UniRef100_Q45W78 Cluster: Ubiquitin fusion protein; n=3; core
eudicotyledons|Rep: Ubiquitin fusion protein - Arachis
hypogaea (Peanut), complete
Length = 664
Score = 773 bits (390), Expect = 0.0
Identities = 390/390 (100%)
Strand = Plus / Plus
Query: 1 atgcagatcttcgtgaaaaccctgaccggcaagaccatcaccctcgaggtggagtcaagc 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 46 atgcagatcttcgtgaaaaccctgaccggcaagaccatcaccctcgaggtggagtcaagc 105
Query: 61 gacaccatcgacaacgtcaaagcgaagatccaggacaaagaagggattccaccggaccag 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 106 gacaccatcgacaacgtcaaagcgaagatccaggacaaagaagggattccaccggaccag 165
Query: 121 cagaggttgatcttcgccgggaagcagcttgaggatggccgtaccctcgccgattacaac 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 166 cagaggttgatcttcgccgggaagcagcttgaggatggccgtaccctcgccgattacaac 225
Query: 181 atccagaaagagtcaaccttgcatcttgttttgaggcttcgtggtggcattattgagcca 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 226 atccagaaagagtcaaccttgcatcttgttttgaggcttcgtggtggcattattgagcca 285
Query: 241 tctctgatggcattggccaggaagtataaccaggacaagatgatctgccgcaagtgttat 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 286 tctctgatggcattggccaggaagtataaccaggacaagatgatctgccgcaagtgttat 345
Query: 301 gcacgtctgcatccccgtgctgtcaactgcaggaaaaagaagtgtggacacagcaaccag 360
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 346 gcacgtctgcatccccgtgctgtcaactgcaggaaaaagaagtgtggacacagcaaccag 405
Query: 361 ttgaggccgaagaagaagatcaagtaaact 390
||||||||||||||||||||||||||||||
Sbjct: 406 ttgaggccgaagaagaagatcaagtaaact 435
>gnl|LJGI|BW604401 UniRef100_A0MKC8 Cluster: Ubiquitin extension protein; n=2; core
eudicotyledons|Rep: Ubiquitin extension protein -
Capsicum annuum (Bell pepper), partial (43%)
Length = 339
Score = 226 bits (114), Expect = 8e-59
Identities = 177/198 (89%)
Strand = Plus / Plus
Query: 1 atgcagatcttcgtgaaaaccctgaccggcaagaccatcaccctcgaggtggagtcaagc 60
||||||||||||||||| ||||| ||||| ||||||||||| |||||||| ||| |
Sbjct: 112 atgcagatcttcgtgaagaccctcaccggaaagaccatcactctcgaggtcgagagctcc 171
Query: 61 gacaccatcgacaacgtcaaagcgaagatccaggacaaagaagggattccaccggaccag 120
||||||||||||||||| || || ||||||||||| || || |||||||| |||||||||
Sbjct: 172 gacaccatcgacaacgttaaggcaaagatccaggataaggaggggattcccccggaccag 231
Query: 121 cagaggttgatcttcgccgggaagcagcttgaggatggccgtaccctcgccgattacaac 180
|||||||||||||||||||| ||||||||||||||||| |||||||||||||| ||||||
Sbjct: 232 cagaggttgatcttcgccggaaagcagcttgaggatggtcgtaccctcgccgactacaac 291
Query: 181 atccagaaagagtcaacc 198
|||||||| |||||||||
Sbjct: 292 atccagaaggagtcaacc 309
>gnl|LJGI|BW629410 UniRef100_A1X1E5 Cluster: Polyubiquitin; n=1; Thlaspi
caerulescens|Rep: Polyubiquitin - Thlaspi caerulescens
(Alpine penny-cress) (Thlaspi calaminare), partial (31%)
Length = 477
Score = 226 bits (114), Expect = 8e-59
Identities = 177/198 (89%)
Strand = Plus / Plus
Query: 1 atgcagatcttcgtgaaaaccctgaccggcaagaccatcaccctcgaggtggagtcaagc 60
||||||||||||||||| ||||| ||||| ||||||||||| |||||||| ||| |
Sbjct: 124 atgcagatcttcgtgaagaccctcaccggaaagaccatcactctcgaggtcgagagctcc 183
Query: 61 gacaccatcgacaacgtcaaagcgaagatccaggacaaagaagggattccaccggaccag 120
||||||||||||||||| || || ||||||||||| || || |||||||| |||||||||
Sbjct: 184 gacaccatcgacaacgttaaggcaaagatccaggataaggaggggattcccccggaccag 243
Query: 121 cagaggttgatcttcgccgggaagcagcttgaggatggccgtaccctcgccgattacaac 180
|||||||||||||||||||| ||||||||||||||||| |||||||||||||| ||||||
Sbjct: 244 cagaggttgatcttcgccggaaagcagcttgaggatggtcgtaccctcgccgactacaac 303
Query: 181 atccagaaagagtcaacc 198
|||||||| |||||||||
Sbjct: 304 atccagaaggagtcaacc 321
Score = 105 bits (53), Expect = 2e-22
Identities = 111/129 (86%), Gaps = 6/129 (4%)
Strand = Plus / Plus
Query: 1 atgcagatcttcgtgaaaaccctgaccggcaagaccatcaccctcgaggtggagtcaagc 60
||||||||||||||||| ||||| |||||||||||||||||||||||||| || ||||
Sbjct: 352 atgcagatcttcgtgaagaccctcaccggcaagaccatcaccctcgaggtcga---aagc 408
Query: 61 ---gacaccatcgacaacgtcaaagcgaagatccaggacaaagaagggattccaccggac 117
||||| || ||||||||||| || |||||||||||||| || || ||||| |||||
Sbjct: 409 tctgacactattgacaacgtcaaggctaagatccaggacaaggagggaattcccccggat 468
Query: 118 cagcagagg 126
|||||||||
Sbjct: 469 cagcagagg 477
>gnl|LJGI|BW620072 UniRef100_A0MKC8 Cluster: Ubiquitin extension protein; n=2; core
eudicotyledons|Rep: Ubiquitin extension protein -
Capsicum annuum (Bell pepper), partial (43%)
Length = 336
Score = 226 bits (114), Expect = 8e-59
Identities = 177/198 (89%)
Strand = Plus / Plus
Query: 1 atgcagatcttcgtgaaaaccctgaccggcaagaccatcaccctcgaggtggagtcaagc 60
||||||||||||||||| ||||| ||||| ||||||||||| |||||||| ||| |
Sbjct: 109 atgcagatcttcgtgaagaccctcaccggaaagaccatcactctcgaggtcgagagctcc 168
Query: 61 gacaccatcgacaacgtcaaagcgaagatccaggacaaagaagggattccaccggaccag 120
||||||||||||||||| || || ||||||||||| || || |||||||| |||||||||
Sbjct: 169 gacaccatcgacaacgttaaggcaaagatccaggataaggaggggattcccccggaccag 228
Query: 121 cagaggttgatcttcgccgggaagcagcttgaggatggccgtaccctcgccgattacaac 180
|||||||||||||||||||| ||||||||||||||||| |||||||||||||| ||||||
Sbjct: 229 cagaggttgatcttcgccggaaagcagcttgaggatggtcgtaccctcgccgactacaac 288
Query: 181 atccagaaagagtcaacc 198
|||||||| |||||||||
Sbjct: 289 atccagaaggagtcaacc 306
>gnl|LJGI|TC81113 UniRef100_A1X1E5 Cluster: Polyubiquitin; n=1; Thlaspi
caerulescens|Rep: Polyubiquitin - Thlaspi caerulescens
(Alpine penny-cress) (Thlaspi calaminare), partial (67%)
Length = 881
Score = 226 bits (114), Expect = 8e-59
Identities = 177/198 (89%)
Strand = Plus / Plus
Query: 1 atgcagatcttcgtgaaaaccctgaccggcaagaccatcaccctcgaggtggagtcaagc 60
||||||||||||||||| ||||| ||||| ||||||||||| |||||||| ||| |
Sbjct: 110 atgcagatcttcgtgaagaccctcaccggaaagaccatcactctcgaggtcgagagctcc 169
Query: 61 gacaccatcgacaacgtcaaagcgaagatccaggacaaagaagggattccaccggaccag 120
||||||||||||||||| || || ||||||||||| || || |||||||| |||||||||
Sbjct: 170 gacaccatcgacaacgttaaggcaaagatccaggataaggaggggattcccccggaccag 229
Query: 121 cagaggttgatcttcgccgggaagcagcttgaggatggccgtaccctcgccgattacaac 180
|||||||||||||||||||| ||||||||||||||||| |||||||||||||| ||||||
Sbjct: 230 cagaggttgatcttcgccggaaagcagcttgaggatggtcgtaccctcgccgactacaac 289
Query: 181 atccagaaagagtcaacc 198
|||||||| |||||||||
Sbjct: 290 atccagaaggagtcaacc 307
Score = 168 bits (85), Expect = 2e-41
Identities = 170/197 (86%), Gaps = 6/197 (3%)
Strand = Plus / Plus
Query: 1 atgcagatcttcgtgaaaaccctgaccggcaagaccatcaccctcgaggtggagtcaagc 60
||||||||||||||||| ||||| || ||||||||||||||||||||||| || ||||
Sbjct: 338 atgcagatcttcgtgaagaccctcactggcaagaccatcaccctcgaggtcga---aagc 394
Query: 61 ---gacaccatcgacaacgtcaaagcgaagatccaggacaaagaagggattccaccggac 117
||||| || ||||||||||| || |||||||||||||| || || ||||| |||||
Sbjct: 395 tctgacactattgacaacgtcaaggctaagatccaggacaaggagggaattcccccggat 454
Query: 118 cagcagaggttgatcttcgccgggaagcagcttgaggatggccgtaccctcgccgattac 177
||||||||||||||||||||||| |||||||| |||||||| || ||| | ||||| |||
Sbjct: 455 cagcagaggttgatcttcgccggcaagcagctcgaggatggtcgcaccttggccgactac 514
Query: 178 aacatccagaaagagtc 194
||||||||||| |||||
Sbjct: 515 aacatccagaaggagtc 531
Score = 151 bits (76), Expect = 4e-36
Identities = 160/188 (85%)
Strand = Plus / Plus
Query: 1 atgcagatcttcgtgaaaaccctgaccggcaagaccatcaccctcgaggtggagtcaagc 60
|||||||||||||| || ||| |||| ||||||||||||||||| ||||| |||
Sbjct: 566 atgcagatcttcgtcaagaccttgactggcaagaccatcacccttgaggttgagagctct 625
Query: 61 gacaccatcgacaacgtcaaagcgaagatccaggacaaagaagggattccaccggaccag 120
|||||||||||||||||||| || |||||||| ||||| || || || || |||||||||
Sbjct: 626 gacaccatcgacaacgtcaaggctaagatccaagacaaggagggaatccccccggaccag 685
Query: 121 cagaggttgatcttcgccgggaagcagcttgaggatggccgtaccctcgccgattacaac 180
|||||||||||||| ||||| |||||||| |||||||| || ||||| || || ||||||
Sbjct: 686 cagaggttgatctttgccggcaagcagctcgaggatggtcgcacccttgctgactacaac 745
Query: 181 atccagaa 188
||||||||
Sbjct: 746 atccagaa 753
>gnl|LJGI|TC79728 UniRef100_Q7EUR6 Cluster: AT4g05320/C17L7_240; n=8; core
eudicotyledons|Rep: AT4g05320/C17L7_240 - Arabidopsis
thaliana (Mouse-ear cress), complete
Length = 1440
Score = 226 bits (114), Expect = 8e-59
Identities = 177/198 (89%)
Strand = Plus / Plus
Query: 1 atgcagatcttcgtgaaaaccctgaccggcaagaccatcaccctcgaggtggagtcaagc 60
||||||||||||||||| ||||| ||||| ||||||||||| |||||||| ||| |
Sbjct: 101 atgcagatcttcgtgaagaccctcaccggaaagaccatcactctcgaggtcgagagctcc 160
Query: 61 gacaccatcgacaacgtcaaagcgaagatccaggacaaagaagggattccaccggaccag 120
||||||||||||||||| || || ||||||||||| || || |||||||| |||||||||
Sbjct: 161 gacaccatcgacaacgttaaggcaaagatccaggataaggaggggattcccccggaccag 220
Query: 121 cagaggttgatcttcgccgggaagcagcttgaggatggccgtaccctcgccgattacaac 180
|||||||||||||||||||| ||||||||||||||||| |||||||||||||| ||||||
Sbjct: 221 cagaggttgatcttcgccggaaagcagcttgaggatggtcgtaccctcgccgactacaac 280
Query: 181 atccagaaagagtcaacc 198
|||||||| |||||||||
Sbjct: 281 atccagaaggagtcaacc 298
Score = 168 bits (85), Expect = 2e-41
Identities = 170/197 (86%), Gaps = 6/197 (3%)
Strand = Plus / Plus
Query: 1 atgcagatcttcgtgaaaaccctgaccggcaagaccatcaccctcgaggtggagtcaagc 60
||||||||||||||||| ||||| || ||||||||||||||||||||||| || ||||
Sbjct: 329 atgcagatcttcgtgaagaccctcactggcaagaccatcaccctcgaggtcga---aagc 385
Query: 61 ---gacaccatcgacaacgtcaaagcgaagatccaggacaaagaagggattccaccggac 117
||||| || ||||||||||| || |||||||||||||| || || ||||| |||||
Sbjct: 386 tctgacactattgacaacgtcaaggctaagatccaggacaaggagggaattcccccggat 445
Query: 118 cagcagaggttgatcttcgccgggaagcagcttgaggatggccgtaccctcgccgattac 177
||||||||||||||||||||||| |||||||| |||||||| || ||| | ||||| |||
Sbjct: 446 cagcagaggttgatcttcgccggcaagcagctcgaggatggtcgcaccttggccgactac 505
Query: 178 aacatccagaaagagtc 194
||||||||||| |||||
Sbjct: 506 aacatccagaaggagtc 522
Score = 151 bits (76), Expect = 4e-36
Identities = 160/188 (85%)
Strand = Plus / Plus
Query: 1 atgcagatcttcgtgaaaaccctgaccggcaagaccatcaccctcgaggtggagtcaagc 60
|||||||||||||| || ||| |||| ||||||||||||||||| ||||| |||
Sbjct: 557 atgcagatcttcgtcaagaccttgactggcaagaccatcacccttgaggttgagagctct 616
Query: 61 gacaccatcgacaacgtcaaagcgaagatccaggacaaagaagggattccaccggaccag 120
|||||||||||||||||||| || |||||||| ||||| || || || || |||||||||
Sbjct: 617 gacaccatcgacaacgtcaaggctaagatccaagacaaggagggaatccccccggaccag 676
Query: 121 cagaggttgatcttcgccgggaagcagcttgaggatggccgtaccctcgccgattacaac 180
|||||||||||||| ||||| |||||||| |||||||| || ||||| || || ||||||
Sbjct: 677 cagaggttgatctttgccggcaagcagctcgaggatggtcgcacccttgctgactacaac 736
Query: 181 atccagaa 188
||||||||
Sbjct: 737 atccagaa 744
Score = 107 bits (54), Expect = 5e-23
Identities = 159/194 (81%)
Strand = Plus / Plus
Query: 1 atgcagatcttcgtgaaaaccctgaccggcaagaccatcaccctcgaggtggagtcaagc 60
||||||||||| ||||| ||| |||| || |||||||| ||||| ||||||||| |
Sbjct: 1013 atgcagatctttgtgaagaccttgactggtaagaccattaccctggaggtggagagctcc 1072
Query: 61 gacaccatcgacaacgtcaaagcgaagatccaggacaaagaagggattccaccggaccag 120
|| ||||| |||||||| || || || || || ||||| ||||| || ||||||||||||
Sbjct: 1073 gataccattgacaacgtgaaggcaaaaattcaagacaaggaaggtatcccaccggaccag 1132
Query: 121 cagaggttgatcttcgccgggaagcagcttgaggatggccgtaccctcgccgattacaac 180
|||||||||||||| || ||||||||| | |||||||| | ||||| || || ||||||
Sbjct: 1133 cagaggttgatctttgcagggaagcagttggaggatggaaggacccttgctgactacaac 1192
Query: 181 atccagaaagagtc 194
|| ||||| |||||
Sbjct: 1193 attcagaaggagtc 1206
Score = 105 bits (53), Expect = 2e-22
Identities = 170/209 (81%)
Strand = Plus / Plus
Query: 1 atgcagatcttcgtgaaaaccctgaccggcaagaccatcaccctcgaggtggagtcaagc 60
|||||||| |||||||| || |||| || ||||||||||| || |||||||||
Sbjct: 785 atgcagattttcgtgaagactttgactggtaagaccatcactcttgaggtggagagctct 844
Query: 61 gacaccatcgacaacgtcaaagcgaagatccaggacaaagaagggattccaccggaccag 120
|||||||| |||||||| || || ||||||||||| || || || ||||| ||||| |||
Sbjct: 845 gacaccattgacaacgtgaaggctaagatccaggataaggagggtattcccccggatcag 904
Query: 121 cagaggttgatcttcgccgggaagcagcttgaggatggccgtaccctcgccgattacaac 180
||||||||||| || || || |||||||| |||||||| | || || || |||||||||
Sbjct: 905 cagaggttgatttttgctggtaagcagctcgaggatggaaggactcttgcggattacaac 964
Query: 181 atccagaaagagtcaaccttgcatcttgt 209
|||||||| ||||| ||| | ||||||||
Sbjct: 965 atccagaaggagtccacccttcatcttgt 993
>gnl|LJGI|TC65553 UniRef100_Q45W78 Cluster: Ubiquitin fusion protein; n=3; core
eudicotyledons|Rep: Ubiquitin fusion protein - Arachis
hypogaea (Peanut), complete
Length = 627
Score = 226 bits (114), Expect = 8e-59
Identities = 321/390 (82%)
Strand = Plus / Plus
Query: 1 atgcagatcttcgtgaaaaccctgaccggcaagaccatcaccctcgaggtggagtcaagc 60
|||||||| |||||||||||||| || || || |||||||| |||||||| ||| ||
Sbjct: 41 atgcagattttcgtgaaaaccctaactgggaaaaccatcactctcgaggtcgagagcagt 100
Query: 61 gacaccatcgacaacgtcaaagcgaagatccaggacaaagaagggattccaccggaccag 120
|||||||||||||| ||||| || ||||| || ||||| ||||| ||||||||||| |||
Sbjct: 101 gacaccatcgacaatgtcaaggccaagattcaagacaaggaaggcattccaccggatcag 160
Query: 121 cagaggttgatcttcgccgggaagcagcttgaggatggccgtaccctcgccgattacaac 180
||| | | || ||||| |||||||||||||| ||||| | ||| | || |||||||||
Sbjct: 161 cagcgtctcattttcgctgggaagcagcttgaagatggaagaaccttggctgattacaac 220
Query: 181 atccagaaagagtcaaccttgcatcttgttttgaggcttcgtggtggcattattgagcca 240
|| || || || || || | |||||||| |||| |||||||| || || ||||||||
Sbjct: 221 attcaaaaggaatccacgcttcatcttgtgctgagacttcgtgggggtatcattgagcct 280
Query: 241 tctctgatggcattggccaggaagtataaccaggacaagatgatctgccgcaagtgttat 300
|| ||||||| ||||| | || || || ||||||||||||||||||||||| || |||
Sbjct: 281 tcattgatggctttggctcgcaaatacaatcaggacaagatgatctgccgcaaatgctat 340
Query: 301 gcacgtctgcatccccgtgctgtcaactgcaggaaaaagaagtgtggacacagcaaccag 360
|| ||||||||||| | ||||| |||||| | |||||||||||||| ||||| || |||
Sbjct: 341 gctcgtctgcatccaagggctgtaaactgccgcaaaaagaagtgtggtcacagtaatcag 400
Query: 361 ttgaggccgaagaagaagatcaagtaaact 390
|||||||| |||||||||||||||||||||
Sbjct: 401 ttgaggccaaagaagaagatcaagtaaact 430
>gnl|LJGI|TC66444 UniRef100_Q45W78 Cluster: Ubiquitin fusion protein; n=3; core
eudicotyledons|Rep: Ubiquitin fusion protein - Arachis
hypogaea (Peanut), complete
Length = 674
Score = 222 bits (112), Expect = 1e-57
Identities = 319/388 (82%)
Strand = Plus / Plus
Query: 1 atgcagatcttcgtgaaaaccctgaccggcaagaccatcaccctcgaggtggagtcaagc 60
|||||||| |||||||||||||| || || |||||||| ||||| ||||| ||| |||
Sbjct: 53 atgcagatattcgtgaaaaccctaactgggaagaccataacccttgaggtcgagagcagc 112
Query: 61 gacaccatcgacaacgtcaaagcgaagatccaggacaaagaagggattccaccggaccag 120
|||||||| ||||| |||||||| ||||| || ||||||||||| ||||||||||| |||
Sbjct: 113 gacaccattgacaatgtcaaagctaagattcaagacaaagaaggcattccaccggatcag 172
Query: 121 cagaggttgatcttcgccgggaagcagcttgaggatggccgtaccctcgccgattacaac 180
||| | |||||||||||||| |||||||| || ||||| || ||||| || |||||||||
Sbjct: 173 cagcgtttgatcttcgccggaaagcagctggaagatgggcgaaccctagcggattacaac 232
Query: 181 atccagaaagagtcaaccttgcatcttgttttgaggcttcgtggtggcattattgagcca 240
|||||||| || ||||| | |||||||| | |||||||| ||||| || ||||| ||
Sbjct: 233 atccagaaggaatcaactcttcatcttgtcctcaggcttcgcggtggtatcattgaacct 292
Query: 241 tctctgatggcattggccaggaagtataaccaggacaagatgatctgccgcaagtgttat 300
|| ||||||| | || | || || || || ||||||||||| |||||||| || |||
Sbjct: 293 tcattgatggctcttgctcgcaaatacaatcaagacaagatgatttgccgcaaatgctat 352
Query: 301 gcacgtctgcatccccgtgctgtcaactgcaggaaaaagaagtgtggacacagcaaccag 360
|| ||| | ||||| | || || |||||| | |||||||||||||| || || || |||
Sbjct: 353 gctcgtttacatccgagagccgtgaactgccgcaaaaagaagtgtggtcatagtaatcag 412
Query: 361 ttgaggccgaagaagaagatcaagtaaa 388
|||||||| |||||||||||||||||||
Sbjct: 413 ttgaggccaaagaagaagatcaagtaaa 440
>gnl|LJGI|TC62585 UniRef100_Q45W78 Cluster: Ubiquitin fusion protein; n=3; core
eudicotyledons|Rep: Ubiquitin fusion protein - Arachis
hypogaea (Peanut), complete
Length = 718
Score = 222 bits (112), Expect = 1e-57
Identities = 319/388 (82%)
Strand = Plus / Plus
Query: 1 atgcagatcttcgtgaaaaccctgaccggcaagaccatcaccctcgaggtggagtcaagc 60
|||||||| |||||||||||||| || || |||||||| ||||| ||||| ||| |||
Sbjct: 28 atgcagatattcgtgaaaaccctaactgggaagaccataacccttgaggtcgagagcagc 87
Query: 61 gacaccatcgacaacgtcaaagcgaagatccaggacaaagaagggattccaccggaccag 120
|||||||| ||||| |||||||| ||||| || ||||||||||| ||||||||||| |||
Sbjct: 88 gacaccattgacaatgtcaaagctaagattcaagacaaagaaggcattccaccggatcag 147
Query: 121 cagaggttgatcttcgccgggaagcagcttgaggatggccgtaccctcgccgattacaac 180
||| | |||||||||||||| |||||||| || ||||| || ||||| || |||||||||
Sbjct: 148 cagcgtttgatcttcgccggaaagcagctggaagatgggcgaaccctagcggattacaac 207
Query: 181 atccagaaagagtcaaccttgcatcttgttttgaggcttcgtggtggcattattgagcca 240
|||||||| || ||||| | |||||||| | |||||||| ||||| || ||||| ||
Sbjct: 208 atccagaaggaatcaactcttcatcttgtcctcaggcttcgcggtggtatcattgaacct 267
Query: 241 tctctgatggcattggccaggaagtataaccaggacaagatgatctgccgcaagtgttat 300
|| ||||||| | || | || || || || ||||||||||| |||||||| || |||
Sbjct: 268 tcattgatggctcttgctcgcaaatacaatcaagacaagatgatttgccgcaaatgctat 327
Query: 301 gcacgtctgcatccccgtgctgtcaactgcaggaaaaagaagtgtggacacagcaaccag 360
|| ||| | ||||| | || || |||||| | |||||||||||||| || || || |||
Sbjct: 328 gctcgtttacatccgagagccgtgaactgccgcaaaaagaagtgtggtcatagtaatcag 387
Query: 361 ttgaggccgaagaagaagatcaagtaaa 388
|||||||| |||||||||||||||||||
Sbjct: 388 ttgaggccaaagaagaagatcaagtaaa 415
>gnl|LJGI|BW623364 homologue to UniRef100_A1CKM6 Cluster: Ubiquitin; n=2;
Aspergillus|Rep: Ubiquitin - Aspergillus clavatus,
partial (50%)
Length = 332
Score = 218 bits (110), Expect = 2e-56
Identities = 176/198 (88%)
Strand = Plus / Plus
Query: 1 atgcagatcttcgtgaaaaccctgaccggcaagaccatcaccctcgaggtggagtcaagc 60
||||||||||||||||| ||||| ||||| ||||||||||| |||||||| ||| |
Sbjct: 105 atgcagatcttcgtgaagaccctcaccggaaagaccatcactctcgaggtcgagagctcc 164
Query: 61 gacaccatcgacaacgtcaaagcgaagatccaggacaaagaagggattccaccggaccag 120
||||||||||||||||| || || ||||||||||| || || |||||||| || ||||||
Sbjct: 165 gacaccatcgacaacgttaaggcaaagatccaggataaggaggggattcccccagaccag 224
Query: 121 cagaggttgatcttcgccgggaagcagcttgaggatggccgtaccctcgccgattacaac 180
|||||||||||||||||||| ||||||||||||||||| |||||||||||||| ||||||
Sbjct: 225 cagaggttgatcttcgccggaaagcagcttgaggatggtcgtaccctcgccgactacaac 284
Query: 181 atccagaaagagtcaacc 198
|||||||| |||||||||
Sbjct: 285 atccagaaggagtcaacc 302
>gnl|LJGI|TC79823 UniRef100_A1X1E5 Cluster: Polyubiquitin; n=1; Thlaspi
caerulescens|Rep: Polyubiquitin - Thlaspi caerulescens
(Alpine penny-cress) (Thlaspi calaminare), partial (38%)
Length = 507
Score = 218 bits (110), Expect = 2e-56
Identities = 173/194 (89%)
Strand = Plus / Plus
Query: 5 agatcttcgtgaaaaccctgaccggcaagaccatcaccctcgaggtggagtcaagcgaca 64
||||||||||||| ||||| ||||| ||||||||||| |||||||| ||| |||||
Sbjct: 70 agatcttcgtgaagaccctcaccggaaagaccatcactctcgaggtcgagagctccgaca 129
Query: 65 ccatcgacaacgtcaaagcgaagatccaggacaaagaagggattccaccggaccagcaga 124
||||||||||||| || || ||||||||||| || || |||||||| |||||||||||||
Sbjct: 130 ccatcgacaacgttaaggcaaagatccaggataaggaggggattcccccggaccagcaga 189
Query: 125 ggttgatcttcgccgggaagcagcttgaggatggccgtaccctcgccgattacaacatcc 184
|||||||||||||||| ||||||||||||||||| |||||||||||||| ||||||||||
Sbjct: 190 ggttgatcttcgccggaaagcagcttgaggatggtcgtaccctcgccgactacaacatcc 249
Query: 185 agaaagagtcaacc 198
|||| |||||||||
Sbjct: 250 agaaggagtcaacc 263
Score = 168 bits (85), Expect = 2e-41
Identities = 170/197 (86%), Gaps = 6/197 (3%)
Strand = Plus / Plus
Query: 1 atgcagatcttcgtgaaaaccctgaccggcaagaccatcaccctcgaggtggagtcaagc 60
||||||||||||||||| ||||| || ||||||||||||||||||||||| || ||||
Sbjct: 294 atgcagatcttcgtgaagaccctcactggcaagaccatcaccctcgaggtcga---aagc 350
Query: 61 ---gacaccatcgacaacgtcaaagcgaagatccaggacaaagaagggattccaccggac 117
||||| || ||||||||||| || |||||||||||||| || || ||||| |||||
Sbjct: 351 tctgacactattgacaacgtcaaggctaagatccaggacaaggagggaattcccccggat 410
Query: 118 cagcagaggttgatcttcgccgggaagcagcttgaggatggccgtaccctcgccgattac 177
||||||||||||||||||||||| |||||||| |||||||| || ||| | ||||| |||
Sbjct: 411 cagcagaggttgatcttcgccggcaagcagctcgaggatggtcgcaccttggccgactac 470
Query: 178 aacatccagaaagagtc 194
||||||||||| |||||
Sbjct: 471 aacatccagaaggagtc 487
>gnl|LJGI|TC82572 homologue to UniRef100_A1X1E5 Cluster: Polyubiquitin; n=1; Thlaspi
caerulescens|Rep: Polyubiquitin - Thlaspi caerulescens
(Alpine penny-cress) (Thlaspi calaminare), partial (44%)
Length = 717
Score = 210 bits (106), Expect = 5e-54
Identities = 175/198 (88%)
Strand = Plus / Plus
Query: 1 atgcagatcttcgtgaaaaccctgaccggcaagaccatcaccctcgaggtggagtcaagc 60
||||||||||||||||| |||| |||| ||||||||||| |||||||| ||| |
Sbjct: 59 atgcagatcttcgtgaagaccccctccggaaagaccatcactctcgaggtcgagagctcc 118
Query: 61 gacaccatcgacaacgtcaaagcgaagatccaggacaaagaagggattccaccggaccag 120
||||||||||||||||| || || ||||||||||| || || |||||||| |||||||||
Sbjct: 119 gacaccatcgacaacgttaaggcaaagatccaggataaggaggggattcccccggaccag 178
Query: 121 cagaggttgatcttcgccgggaagcagcttgaggatggccgtaccctcgccgattacaac 180
|||||||||||||||||||| ||||||||||||||||| |||||||||||||| ||||||
Sbjct: 179 cagaggttgatcttcgccggaaagcagcttgaggatggtcgtaccctcgccgactacaac 238
Query: 181 atccagaaagagtcaacc 198
|||||||| |||||||||
Sbjct: 239 atccagaaggagtcaacc 256
Score = 168 bits (85), Expect = 2e-41
Identities = 170/197 (86%), Gaps = 6/197 (3%)
Strand = Plus / Plus
Query: 1 atgcagatcttcgtgaaaaccctgaccggcaagaccatcaccctcgaggtggagtcaagc 60
||||||||||||||||| ||||| || ||||||||||||||||||||||| || ||||
Sbjct: 287 atgcagatcttcgtgaagaccctcactggcaagaccatcaccctcgaggtcga---aagc 343
Query: 61 ---gacaccatcgacaacgtcaaagcgaagatccaggacaaagaagggattccaccggac 117
||||| || ||||||||||| || |||||||||||||| || || ||||| |||||
Sbjct: 344 tctgacactattgacaacgtcaaggctaagatccaggacaaggagggaattcccccggat 403
Query: 118 cagcagaggttgatcttcgccgggaagcagcttgaggatggccgtaccctcgccgattac 177
||||||||||||||||||||||| |||||||| |||||||| || ||| | ||||| |||
Sbjct: 404 cagcagaggttgatcttcgccggcaagcagctcgaggatggtcgcaccttggccgactac 463
Query: 178 aacatccagaaagagtc 194
||||||||||| |||||
Sbjct: 464 aacatccagaaggagtc 480
>gnl|LJGI|BW629347 UniRef100_A1X1E5 Cluster: Polyubiquitin; n=1; Thlaspi
caerulescens|Rep: Polyubiquitin - Thlaspi caerulescens
(Alpine penny-cress) (Thlaspi calaminare), partial (39%)
Length = 532
Score = 202 bits (102), Expect = 1e-51
Identities = 174/198 (87%)
Strand = Plus / Plus
Query: 1 atgcagatcttcgtgaaaaccctgaccggcaagaccatcaccctcgaggtggagtcaagc 60
||||||||||||||||| ||||| ||||| ||||||||||| ||| || ||| |
Sbjct: 88 atgcagatcttcgtgaagaccctcaccggaaagaccatcactctctttgtcgagagctcc 147
Query: 61 gacaccatcgacaacgtcaaagcgaagatccaggacaaagaagggattccaccggaccag 120
||||||||||||||||| || || ||||||||||| || || |||||||| |||||||||
Sbjct: 148 gacaccatcgacaacgttaaggcaaagatccaggataaggaggggattcccccggaccag 207
Query: 121 cagaggttgatcttcgccgggaagcagcttgaggatggccgtaccctcgccgattacaac 180
|||||||||||||||||||| ||||||||||||||||| |||||||||||||| ||||||
Sbjct: 208 cagaggttgatcttcgccggaaagcagcttgaggatggtcgtaccctcgccgactacaac 267
Query: 181 atccagaaagagtcaacc 198
|||||||| |||||||||
Sbjct: 268 atccagaaggagtcaacc 285
Score = 168 bits (85), Expect = 2e-41
Identities = 170/197 (86%), Gaps = 6/197 (3%)
Strand = Plus / Plus
Query: 1 atgcagatcttcgtgaaaaccctgaccggcaagaccatcaccctcgaggtggagtcaagc 60
||||||||||||||||| ||||| || ||||||||||||||||||||||| || ||||
Sbjct: 316 atgcagatcttcgtgaagaccctcactggcaagaccatcaccctcgaggtcga---aagc 372
Query: 61 ---gacaccatcgacaacgtcaaagcgaagatccaggacaaagaagggattccaccggac 117
||||| || ||||||||||| || |||||||||||||| || || ||||| |||||
Sbjct: 373 tctgacactattgacaacgtcaaggctaagatccaggacaaggagggaattcccccggat 432
Query: 118 cagcagaggttgatcttcgccgggaagcagcttgaggatggccgtaccctcgccgattac 177
||||||||||||||||||||||| |||||||| |||||||| || ||| | ||||| |||
Sbjct: 433 cagcagaggttgatcttcgccggcaagcagctcgaggatggtcgcaccttggccgactac 492
Query: 178 aacatccagaaagagtc 194
||||||||||| |||||
Sbjct: 493 aacatccagaaggagtc 509
>gnl|LJGI|TC64176 homologue to UniRef100_A0MKC8 Cluster: Ubiquitin extension protein;
n=2; core eudicotyledons|Rep: Ubiquitin extension
protein - Capsicum annuum (Bell pepper), partial (85%)
Length = 685
Score = 202 bits (102), Expect = 1e-51
Identities = 171/194 (88%)
Strand = Plus / Plus
Query: 1 atgcagatcttcgtgaaaaccctgaccggcaagaccatcaccctcgaggtggagtcaagc 60
||||||||||||||||||||||| || || ||||| |||||||||||||||||||| |
Sbjct: 43 atgcagatcttcgtgaaaaccctaacggggaagacgatcaccctcgaggtggagtcttcc 102
Query: 61 gacaccatcgacaacgtcaaagcgaagatccaggacaaagaagggattccaccggaccag 120
||||| |||||||| || ||||| |||||||||||||| || || ||||| |||||||||
Sbjct: 103 gacacaatcgacaatgtgaaagccaagatccaggacaaggagggaattcccccggaccag 162
Query: 121 cagaggttgatcttcgccgggaagcagcttgaggatggccgtaccctcgccgattacaac 180
|||||||||||||||||||| ||||| || || || ||||| ||||||||||| ||||||
Sbjct: 163 cagaggttgatcttcgccggaaagcaactcgaagacggccgcaccctcgccgactacaac 222
Query: 181 atccagaaagagtc 194
|||||||| |||||
Sbjct: 223 atccagaaggagtc 236
>gnl|LJGI|TC79910 UniRef100_A1X1E5 Cluster: Polyubiquitin; n=1; Thlaspi
caerulescens|Rep: Polyubiquitin - Thlaspi caerulescens
(Alpine penny-cress) (Thlaspi calaminare), partial (36%)
Length = 487
Score = 176 bits (89), Expect = 7e-44
Identities = 171/197 (86%), Gaps = 6/197 (3%)
Strand = Plus / Plus
Query: 1 atgcagatcttcgtgaaaaccctgaccggcaagaccatcaccctcgaggtggagtcaagc 60
||||||||||||||||| ||||| ||||| |||||||||||||||||||| || ||||
Sbjct: 70 atgcagatcttcgtgaagaccctcaccggaaagaccatcaccctcgaggtcga---aagc 126
Query: 61 ---gacaccatcgacaacgtcaaagcgaagatccaggacaaagaagggattccaccggac 117
||||| |||||||||||||| || |||||||||||||| || || ||||| |||||
Sbjct: 127 tctgacactatcgacaacgtcaaggctaagatccaggacaaggagggaattcccccggat 186
Query: 118 cagcagaggttgatcttcgccgggaagcagcttgaggatggccgtaccctcgccgattac 177
||||||||||||||||||||||| |||||||| |||||||| || ||| | ||||| |||
Sbjct: 187 cagcagaggttgatcttcgccggcaagcagctcgaggatggtcgcaccttggccgactac 246
Query: 178 aacatccagaaagagtc 194
||||||||||| |||||
Sbjct: 247 aacatccagaaggagtc 263
Score = 143 bits (72), Expect = 9e-34
Identities = 159/188 (84%)
Strand = Plus / Plus
Query: 1 atgcagatcttcgtgaaaaccctgaccggcaagaccatcaccctcgaggtggagtcaagc 60
|||||||||||||| || ||| |||| ||||||||||||||||| ||||| |||
Sbjct: 298 atgcagatcttcgtcaagaccttgactggcaagaccatcacccttgaggttgagagctct 357
Query: 61 gacaccatcgacaacgtcaaagcgaagatccaggacaaagaagggattccaccggaccag 120
|||||||||||||||||||| || |||||||| ||||| || || || || |||||||||
Sbjct: 358 gacaccatcgacaacgtcaaggctaagatccaagacaaggagggaatccccccggaccag 417
Query: 121 cagaggttgatcttcgccgggaagcagcttgaggatggccgtaccctcgccgattacaac 180
|||||| ||||||| ||||| |||||||| |||||||| || ||||| || || ||||||
Sbjct: 418 cagaggctgatctttgccggcaagcagctcgaggatggtcgcacccttgctgactacaac 477
Query: 181 atccagaa 188
||||||||
Sbjct: 478 atccagaa 485
>gnl|LJGI|TC62881 homologue to UniRef100_Q06H21 Cluster: Ubiquitin/ribosomal protein
S27a; n=1; Arachis hypogaea|Rep: Ubiquitin/ribosomal
protein S27a - Arachis hypogaea (Peanut), complete
Length = 717
Score = 170 bits (86), Expect = 4e-42
Identities = 167/194 (86%)
Strand = Plus / Plus
Query: 1 atgcagatcttcgtgaaaaccctgaccggcaagaccatcaccctcgaggtggagtcaagc 60
||||||||||||||||||||||| || || ||||| ||||||||||||||||||||| |
Sbjct: 81 atgcagatcttcgtgaaaaccctaacggggaagacgatcaccctcgaggtggagtcatcc 140
Query: 61 gacaccatcgacaacgtcaaagcgaagatccaggacaaagaagggattccaccggaccag 120
||||| |||||||||||||| || |||||||| ||||| || || || ||||||||||||
Sbjct: 141 gacacaatcgacaacgtcaaggccaagatccaagacaaggagggaatcccaccggaccag 200
Query: 121 cagaggttgatcttcgccgggaagcagcttgaggatggccgtaccctcgccgattacaac 180
||| | | |||||||||||||||||||| || || ||||| || || || || ||||||
Sbjct: 201 cagcgtctcatcttcgccgggaagcagctggaagacggccgcacacttgctgactacaac 260
Query: 181 atccagaaagagtc 194
|||||||| |||||
Sbjct: 261 atccagaaggagtc 274
>gnl|LJGI|TC76922 homologue to UniRef100_A7QD64 Cluster: Chromosome undetermined
scaffold_80, whole genome shotgun sequence; n=1; Vitis
vinifera|Rep: Chromosome undetermined scaffold_80, whole
genome shotgun sequence - Vitis vinifera (Grape),
partial (98%)
Length = 879
Score = 139 bits (70), Expect = 1e-32
Identities = 154/182 (84%)
Strand = Plus / Plus
Query: 1 atgcagatcttcgtgaaaaccctgaccggcaagaccatcaccctcgaggtggagtcaagc 60
||||||||||| ||||| || |||| || |||||||||||||||||||| ||| |||
Sbjct: 167 atgcagatctttgtgaagactttgactggaaagaccatcaccctcgaggttgagagcagc 226
Query: 61 gacaccatcgacaacgtcaaagcgaagatccaggacaaagaagggattccaccggaccag 120
|||||||||||||||||||| || |||||||||||||| ||||| || || ||||| |||
Sbjct: 227 gacaccatcgacaacgtcaaggccaagatccaggacaaggaaggcatccctccggatcag 286
Query: 121 cagaggttgatcttcgccgggaagcagcttgaggatggccgtaccctcgccgattacaac 180
|| |||||||| || ||||| |||||||| || |||||||| || || || ||||| |||
Sbjct: 287 caaaggttgatttttgccggtaagcagctggaagatggccgcactcttgctgattataac 346
Query: 181 at 182
||
Sbjct: 347 at 348
>gnl|LJGI|AV407232 UniRef100_A0MKC8 Cluster: Ubiquitin extension protein; n=2; core
eudicotyledons|Rep: Ubiquitin extension protein -
Capsicum annuum (Bell pepper), partial (42%)
Length = 361
Score = 123 bits (62), Expect = 9e-28
Identities = 164/198 (82%)
Strand = Plus / Plus
Query: 1 atgcagatcttcgtgaaaaccctgaccggcaagaccatcaccctcgaggtggagtcaagc 60
||||| ||||||||||||||||| ||||| ||||| ||||| |||||||| |||
Sbjct: 135 atgcaaatcttcgtgaaaaccctaaccgggaagacaatcactctcgaggtagagagttca 194
Query: 61 gacaccatcgacaacgtcaaagcgaagatccaggacaaagaagggattccaccggaccag 120
|| ||||| |||||||| ||||| |||||||| ||||| |||||||| ||||| || |||
Sbjct: 195 gataccattgacaacgtgaaagctaagatccaagacaaggaagggatcccacctgatcag 254
Query: 121 cagaggttgatcttcgccgggaagcagcttgaggatggccgtaccctcgccgattacaac 180
|| ||||||||||| || |||||||| | |||||||| || ||||| || || ||||||
Sbjct: 255 caaaggttgatctttgctgggaagcaattggaggatggtcgcacccttgcagactacaac 314
Query: 181 atccagaaagagtcaacc 198
||||| || |||||||||
Sbjct: 315 atccaaaaggagtcaacc 332
>gnl|LJGI|TC78962 UniRef100_Q42397 Cluster: Hexaubiquitin protein; n=1; Helianthus
annuus|Rep: Hexaubiquitin protein - Helianthus annuus
(Common sunflower), complete
Length = 1704
Score = 123 bits (62), Expect = 9e-28
Identities = 164/198 (82%)
Strand = Plus / Plus
Query: 1 atgcagatcttcgtgaaaaccctgaccggcaagaccatcaccctcgaggtggagtcaagc 60
||||| ||||||||||||||||| ||||| ||||| ||||| |||||||| |||
Sbjct: 97 atgcaaatcttcgtgaaaaccctaaccgggaagacaatcactctcgaggtagagagttca 156
Query: 61 gacaccatcgacaacgtcaaagcgaagatccaggacaaagaagggattccaccggaccag 120
|| ||||| |||||||| ||||| |||||||| ||||| |||||||| ||||| || |||
Sbjct: 157 gataccattgacaacgtgaaagctaagatccaagacaaggaagggatcccacctgatcag 216
Query: 121 cagaggttgatcttcgccgggaagcagcttgaggatggccgtaccctcgccgattacaac 180
|| ||||||||||| || |||||||| | |||||||| || ||||| || || ||||||
Sbjct: 217 caaaggttgatctttgctgggaagcaattggaggatggtcgcacccttgcagactacaac 276
Query: 181 atccagaaagagtcaacc 198
||||| || |||||||||
Sbjct: 277 atccaaaaggagtcaacc 294
Score = 119 bits (60), Expect = 1e-26
Identities = 156/188 (82%)
Strand = Plus / Plus
Query: 1 atgcagatcttcgtgaaaaccctgaccggcaagaccatcaccctcgaggtggagtcaagc 60
||||||||||| || || ||| |||| || || || |||||||||||||| || ||
Sbjct: 325 atgcagatctttgtcaagaccttgacagggaaaacaatcaccctcgaggttgaatcctca 384
Query: 61 gacaccatcgacaacgtcaaagcgaagatccaggacaaagaagggattccaccggaccag 120
||||| ||||| || ||||| ||||||||||| |||||||| || ||||| ||||| |||
Sbjct: 385 gacactatcgataatgtcaaggcgaagatccaagacaaagagggtattcctccggatcag 444
Query: 121 cagaggttgatcttcgccgggaagcagcttgaggatggccgtaccctcgccgattacaac 180
|| |||||||| || || ||||||||||| |||||||| | |||||||| |||||||||
Sbjct: 445 caaaggttgatttttgctgggaagcagctggaggatggaaggaccctcgctgattacaac 504
Query: 181 atccagaa 188
||||||||
Sbjct: 505 atccagaa 512
Score = 69.9 bits (35), Expect = 1e-11
Identities = 98/119 (82%)
Strand = Plus / Plus
Query: 85 aagatccaggacaaagaagggattccaccggaccagcagaggttgatcttcgccgggaag 144
||||| |||||||| || || || || ||||||||||||||| | |||||||| |||||
Sbjct: 637 aagattcaggacaaggagggcatccctccggaccagcagaggctcatcttcgctgggaaa 696
Query: 145 cagcttgaggatggccgtaccctcgccgattacaacatccagaaagagtcaaccttgca 203
|| ||||||||||| | ||||| || || || ||||||||||| ||||| ||| ||||
Sbjct: 697 caacttgaggatggaaggacccttgctgactataacatccagaaggagtctaccctgca 755
Score = 69.9 bits (35), Expect = 1e-11
Identities = 119/147 (80%)
Strand = Plus / Plus
Query: 82 gcgaagatccaggacaaagaagggattccaccggaccagcagaggttgatcttcgccggg 141
||||||||||| ||||| || || ||||| || ||||||||||| |||| || || ||
Sbjct: 1318 gcgaagatccaagacaaggagggtattcctccagaccagcagagactgatttttgctggc 1377
Query: 142 aagcagcttgaggatggccgtaccctcgccgattacaacatccagaaagagtcaaccttg 201
|||||| | |||||||| ||||| || || ||||| || || ||||| ||||| ||| ||
Sbjct: 1378 aagcagttggaggatggacgtactctggctgattataatattcagaaggagtccaccctg 1437
Query: 202 catcttgttttgaggcttcgtggtggc 228
|||||||| || | ||||||||||||
Sbjct: 1438 catcttgtcctgcgccttcgtggtggc 1464
Score = 60.0 bits (30), Expect = 1e-08
Identities = 126/158 (79%)
Strand = Plus / Plus
Query: 70 gacaacgtcaaagcgaagatccaggacaaagaagggattccaccggaccagcagaggttg 129
||||| || ||||| ||||| ||||| || ||||| || || ||||| ||||||||| |
Sbjct: 1078 gacaatgtgaaagctaagattcaggataaggaaggtatccctccggatcagcagaggctt 1137
Query: 130 atcttcgccgggaagcagcttgaggatggccgtaccctcgccgattacaacatccagaaa 189
||||| || ||||||||| | || ||||| | ||||| || ||||| || ||||||||
Sbjct: 1138 atctttgctgggaagcagttggaagatggaagaacccttgcagattataatatccagaag 1197
Query: 190 gagtcaaccttgcatcttgttttgaggcttcgtggtgg 227
||||| || |||| | |||||| |||||||||||||
Sbjct: 1198 gagtctacactgcacttggttttgcggcttcgtggtgg 1235
>gnl|LJGI|BW623815 UniRef100_A1X1E5 Cluster: Polyubiquitin; n=1; Thlaspi
caerulescens|Rep: Polyubiquitin - Thlaspi caerulescens
(Alpine penny-cress) (Thlaspi calaminare), partial (33%)
Length = 510
Score = 107 bits (54), Expect = 5e-23
Identities = 159/194 (81%)
Strand = Plus / Plus
Query: 1 atgcagatcttcgtgaaaaccctgaccggcaagaccatcaccctcgaggtggagtcaagc 60
||||| ||||||||||||||| |||| |||||||||||||||||||||||||||
Sbjct: 133 atgcaaatcttcgtgaaaaccttgactggcaagaccatcaccctcgaggtggagagttca 192
Query: 61 gacaccatcgacaacgtcaaagcgaagatccaggacaaagaagggattccaccggaccag 120
|| ||||| ||||| || ||||| |||||||| ||||| |||||||| ||||| || |||
Sbjct: 193 gataccattgacaatgttaaagccaagatccaagacaaggaagggatcccacctgatcag 252
Query: 121 cagaggttgatcttcgccgggaagcagcttgaggatggccgtaccctcgccgattacaac 180
|| ||| | ||||| || |||||||| | |||||||| || ||| | || || ||||||
Sbjct: 253 caaaggcttatctttgctgggaagcaattagaggatggtcgcaccttagcagactacaac 312
Query: 181 atccagaaagagtc 194
|| ||||| |||||
Sbjct: 313 attcagaaggagtc 326
Score = 54.0 bits (27), Expect = 7e-07
Identities = 78/95 (82%)
Strand = Plus / Plus
Query: 37 atcaccctcgaggtggagtcaagcgacaccatcgacaacgtcaaagcgaagatccaggac 96
||||||||||||||||| || |||||||| || || || || |||||||||||||||
Sbjct: 397 atcaccctcgaggtggaatcctcagacaccattgataatgtgaaggcgaagatccaggac 456
Query: 97 aaagaagggattccaccggaccagcagaggttgat 131
||||| || || ||||| || ||||| ||| ||||
Sbjct: 457 aaagagggcatcccaccagatcagcaaaggctgat 491
>gnl|LJGI|TC77422 UniRef100_Q7EUR6 Cluster: AT4g05320/C17L7_240; n=8; core
eudicotyledons|Rep: AT4g05320/C17L7_240 - Arabidopsis
thaliana (Mouse-ear cress), complete
Length = 1468
Score = 107 bits (54), Expect = 5e-23
Identities = 159/194 (81%)
Strand = Plus / Plus
Query: 1 atgcagatcttcgtgaaaaccctgaccggcaagaccatcaccctcgaggtggagtcaagc 60
||||| ||||||||||||||| |||| |||||||||||||||||||||||||||
Sbjct: 104 atgcaaatcttcgtgaaaaccttgactggcaagaccatcaccctcgaggtggagagttca 163
Query: 61 gacaccatcgacaacgtcaaagcgaagatccaggacaaagaagggattccaccggaccag 120
|| ||||| ||||| || ||||| |||||||| ||||| |||||||| ||||| || |||
Sbjct: 164 gataccattgacaatgttaaagccaagatccaagacaaggaagggatcccacctgatcag 223
Query: 121 cagaggttgatcttcgccgggaagcagcttgaggatggccgtaccctcgccgattacaac 180
|| ||| | ||||| || |||||||| | |||||||| || ||| | || || ||||||
Sbjct: 224 caaaggcttatctttgctgggaagcaattagaggatggtcgcaccttagcagactacaac 283
Query: 181 atccagaaagagtc 194
|| ||||| |||||
Sbjct: 284 attcagaaggagtc 297
Score = 91.7 bits (46), Expect = 3e-18
Identities = 130/158 (82%)
Strand = Plus / Plus
Query: 37 atcaccctcgaggtggagtcaagcgacaccatcgacaacgtcaaagcgaagatccaggac 96
||||||||||||||||| || |||||||| || || || || |||||||||||||||
Sbjct: 368 atcaccctcgaggtggaatcctcagacaccattgataatgtgaaggcgaagatccaggac 427
Query: 97 aaagaagggattccaccggaccagcagaggttgatcttcgccgggaagcagcttgaggat 156
||||| || || ||||| || ||||| ||| |||| || || || || || || ||||||
Sbjct: 428 aaagagggcatcccaccagatcagcaaaggctgatttttgctggtaaacaactcgaggat 487
Query: 157 ggccgtaccctcgccgattacaacatccagaaagagtc 194
|| | |||||||||||||||||||||||||| |||||
Sbjct: 488 ggaaggaccctcgccgattacaacatccagaaggagtc 525
Score = 89.7 bits (45), Expect = 1e-17
Identities = 123/149 (82%)
Strand = Plus / Plus
Query: 79 aaagcgaagatccaggacaaagaagggattccaccggaccagcagaggttgatcttcgcc 138
||||| ||||| ||||| || || || |||||||| |||||||||||| | ||||| ||
Sbjct: 866 aaagctaagattcaggataaggagggtattccaccagaccagcagaggcttatctttgct 925
Query: 139 gggaagcagcttgaggatggccgtaccctcgccgattacaacatccagaaagagtcaacc 198
||||||||||| || ||||| | ||||| || |||||||| |||||||| ||||| |||
Sbjct: 926 gggaagcagctggaagatggtaggaccctggctgattacaatatccagaaggagtccacc 985
Query: 199 ttgcatcttgttttgaggcttcgtggtgg 227
|||| | |||||| |||||||||||||
Sbjct: 986 ctgcacttggttttgcggcttcgtggtgg 1014
Score = 73.8 bits (37), Expect = 7e-13
Identities = 94/113 (83%)
Strand = Plus / Plus
Query: 82 gcgaagatccaggacaaagaagggattccaccggaccagcagaggttgatcttcgccggg 141
|||||||| |||||||| || || || || || |||||||||||| | ||||| || |||
Sbjct: 641 gcgaagattcaggacaaggagggcatccctccagaccagcagaggctcatctttgctggg 700
Query: 142 aagcagcttgaggatggccgtaccctcgccgattacaacatccagaaagagtc 194
||||||||||| ||||| | ||||| || ||||| ||||||||||| |||||
Sbjct: 701 aagcagcttgaagatggaagaacccttgctgattataacatccagaaggagtc 753
Score = 61.9 bits (31), Expect = 3e-09
Identities = 118/147 (80%)
Strand = Plus / Plus
Query: 82 gcgaagatccaggacaaagaagggattccaccggaccagcagaggttgatcttcgccggg 141
|||||||| ||||||||||| || ||||| || ||||||||| | |||| || || ||
Sbjct: 1097 gcgaagattcaggacaaagagggtattcctccagaccagcagcgactgatttttgctggc 1156
Query: 142 aagcagcttgaggatggccgtaccctcgccgattacaacatccagaaagagtcaaccttg 201
|||||| | |||||||| || || | || ||||| || |||||||| ||||| ||| ||
Sbjct: 1157 aagcagttggaggatggtcgaactttggcagattataatatccagaaggagtccaccctg 1216
Query: 202 catcttgttttgaggcttcgtggtggc 228
|||||||| || | ||||||||||||
Sbjct: 1217 catcttgtcctgcgccttcgtggtggc 1243
>gnl|LJGI|TC71652 UniRef100_A1X1E5 Cluster: Polyubiquitin; n=1; Thlaspi
caerulescens|Rep: Polyubiquitin - Thlaspi caerulescens
(Alpine penny-cress) (Thlaspi calaminare), partial (56%)
Length = 725
Score = 107 bits (54), Expect = 5e-23
Identities = 159/194 (81%)
Strand = Plus / Plus
Query: 1 atgcagatcttcgtgaaaaccctgaccggcaagaccatcaccctcgaggtggagtcaagc 60
||||||||||| || || || |||| || || ||||||||||| ||||| |||||
Sbjct: 313 atgcagatctttgttaagactttgactgggaaaaccatcacccttgaggttgagtcctcg 372
Query: 61 gacaccatcgacaacgtcaaagcgaagatccaggacaaagaagggattccaccggaccag 120
|||||||| ||||| ||||| |||||||||||||| ||||| || || || || || |||
Sbjct: 373 gacaccattgacaatgtcaaggcgaagatccaggataaagagggcatccctccagatcag 432
Query: 121 cagaggttgatcttcgccgggaagcagcttgaggatggccgtaccctcgccgattacaac 180
||||||||||| || || ||||| || ||||||||||| | ||||| || |||||||||
Sbjct: 433 cagaggttgatttttgctgggaaacaacttgaggatggaaggaccctagctgattacaac 492
Query: 181 atccagaaagagtc 194
|||||||| |||||
Sbjct: 493 atccagaaggagtc 506
Score = 95.6 bits (48), Expect = 2e-19
Identities = 126/152 (82%)
Strand = Plus / Plus
Query: 34 accatcaccctcgaggtggagtcaagcgacaccatcgacaacgtcaaagcgaagatccag 93
||||||||||||||||| || || |||||||| ||||| ||||| ||||||||||||
Sbjct: 574 accatcaccctcgaggttgaatcctcggacaccattgacaatgtcaaggcgaagatccag 633
Query: 94 gacaaagaagggattccaccggaccagcagaggttgatcttcgccgggaagcagcttgag 153
|| ||||| || || || || |||||||||||| | || || |||||||| |||||||||
Sbjct: 634 gataaagagggcatccctccagaccagcagaggcttatttttgccgggaaacagcttgag 693
Query: 154 gatggccgtaccctcgccgattacaacatcca 185
||||| | ||||| || |||||||| |||||
Sbjct: 694 gatggaaggaccctagctgattacaatatcca 725
Score = 75.8 bits (38), Expect = 2e-13
Identities = 146/182 (80%)
Strand = Plus / Plus
Query: 1 atgcagatcttcgtgaaaaccctgaccggcaagaccatcaccctcgaggtggagtcaagc 60
|||||||| || |||||||| || |||||||||||||| ||||| ||||||||
Sbjct: 85 atgcagatttttgtgaaaactctcaccggcaagaccattacccttgaggtggaaagttca 144
Query: 61 gacaccatcgacaacgtcaaagcgaagatccaggacaaagaagggattccaccggaccag 120
|| ||||| ||||| || |||||||| ||||| ||||| |||||||| ||||| || |||
Sbjct: 145 gataccattgacaatgttaaagcgaaaatccaagacaaggaagggatcccacctgatcag 204
Query: 121 cagaggttgatcttcgccgggaagcagcttgaggatggccgtaccctcgccgattacaac 180
|| ||| | ||||| || || ||||| | |||||||| || ||||| || |||||||||
Sbjct: 205 caaaggcttatctttgctggtaagcaattggaggatggtcgcacccttgctgattacaac 264
Query: 181 at 182
||
Sbjct: 265 at 266
>gnl|LJGI|TC67537 UniRef100_Q7EUR6 Cluster: AT4g05320/C17L7_240; n=8; core
eudicotyledons|Rep: AT4g05320/C17L7_240 - Arabidopsis
thaliana (Mouse-ear cress), partial (80%)
Length = 1160
Score = 107 bits (54), Expect = 5e-23
Identities = 159/194 (81%)
Strand = Plus / Plus
Query: 1 atgcagatcttcgtgaaaaccctgaccggcaagaccatcaccctcgaggtggagtcaagc 60
||||||||||| |||||||| ||||||||||||||||||||| | |||||||||
Sbjct: 86 atgcagatctttgtgaaaactctgaccggcaagaccatcaccttagaggtggagagttca 145
Query: 61 gacaccatcgacaacgtcaaagcgaagatccaggacaaagaagggattccaccggaccag 120
|| ||||| || || || ||||| ||||||||||| || |||||||| ||||| || |||
Sbjct: 146 gataccattgataatgtaaaagccaagatccaggataaggaagggatcccacctgatcag 205
Query: 121 cagaggttgatcttcgccgggaagcagcttgaggatggccgtaccctcgccgattacaac 180
|| ||| | ||||| || || |||||| | |||||||| || ||||| || || ||||||
Sbjct: 206 caaaggcttatctttgctggcaagcagttagaggatggtcgcacccttgctgactacaac 265
Query: 181 atccagaaagagtc 194
|||||||| |||||
Sbjct: 266 atccagaaggagtc 279
Score = 99.6 bits (50), Expect = 1e-20
Identities = 158/194 (81%)
Strand = Plus / Plus
Query: 1 atgcagatcttcgtgaaaaccctgaccggcaagaccatcaccctcgaggtggagtcaagc 60
||||||||||| || || ||| |||| || || ||||||||||||||||| || ||
Sbjct: 314 atgcagatctttgtcaagaccttgacagggaaaaccatcaccctcgaggtcgaatcctca 373
Query: 61 gacaccatcgacaacgtcaaagcgaagatccaggacaaagaagggattccaccggaccag 120
|||||||| || || ||||| || ||||||||||||||||| || || ||||| ||||||
Sbjct: 374 gacaccattgataatgtcaaggccaagatccaggacaaagagggtataccacccgaccag 433
Query: 121 cagaggttgatcttcgccgggaagcagcttgaggatggccgtaccctcgccgattacaac 180
|||||| | || || || ||||| || ||||||||||| | ||| | || |||||||||
Sbjct: 434 cagaggcttatttttgctgggaaacaacttgaggatgggaggaccttggctgattacaac 493
Query: 181 atccagaaagagtc 194
|||||||| |||||
Sbjct: 494 atccagaaggagtc 507
Score = 56.0 bits (28), Expect = 2e-07
Identities = 121/152 (79%)
Strand = Plus / Plus
Query: 79 aaagcgaagatccaggacaaagaagggattccaccggaccagcagaggttgatcttcgcc 138
||||| ||||| |||||||| || || || || || |||||||||||| | ||||| ||
Sbjct: 620 aaagccaagattcaggacaaggagggcatcccgccagaccagcagaggctcatctttgct 679
Query: 139 gggaagcagcttgaggatggccgtaccctcgccgattacaacatccagaaagagtcaacc 198
|| || |||||||| ||||| | ||||| || ||||| ||||| ||||| ||||| ||
Sbjct: 680 ggaaaacagcttgaagatggaagaacccttgctgattataacattcagaaggagtctact 739
Query: 199 ttgcatcttgttttgaggcttcgtggtggcat 230
||||| | || ||| |||||||||| |||||
Sbjct: 740 ctgcatttggtgttgcggcttcgtggaggcat 771
>gnl|LJGI|BW626875 homologue to UniRef100_A1X1E5 Cluster: Polyubiquitin; n=1; Thlaspi
caerulescens|Rep: Polyubiquitin - Thlaspi caerulescens
(Alpine penny-cress) (Thlaspi calaminare), partial (31%)
Length = 486
Score = 99.6 bits (50), Expect = 1e-20
Identities = 122/146 (83%)
Strand = Plus / Plus
Query: 1 atgcagatcttcgtgaaaaccctgaccggcaagaccatcaccctcgaggtggagtcaagc 60
||||| ||||||||||||||| |||| |||||||||||||||||||||||||||
Sbjct: 128 atgcaaatcttcgtgaaaaccttgactggcaagaccatcaccctcgaggtggagagttca 187
Query: 61 gacaccatcgacaacgtcaaagcgaagatccaggacaaagaagggattccaccggaccag 120
|| ||||| ||||| || ||||| |||||||| ||||| |||||||| ||||| || |||
Sbjct: 188 gataccattgacaatgttaaagccaagatccaagacaaggaagggatcccacctgatcag 247
Query: 121 cagaggttgatcttcgccgggaagca 146
|| ||| | ||||| || ||||||||
Sbjct: 248 caaaggcttatctttgctgggaagca 273
Score = 54.0 bits (27), Expect = 7e-07
Identities = 78/95 (82%)
Strand = Plus / Plus
Query: 37 atcaccctcgaggtggagtcaagcgacaccatcgacaacgtcaaagcgaagatccaggac 96
||||||||||||||||| || |||||||| || || || || |||||||||||||||
Sbjct: 392 atcaccctcgaggtggaatcctcagacaccattgataatgtgaaggcgaagatccaggac 451
Query: 97 aaagaagggattccaccggaccagcagaggttgat 131
||||| || || ||||| || ||||| ||| ||||
Sbjct: 452 aaagagggcatcccaccagatcagcaaaggctgat 486
>gnl|LJGI|TC60580 UniRef100_Q42397 Cluster: Hexaubiquitin protein; n=1; Helianthus
annuus|Rep: Hexaubiquitin protein - Helianthus annuus
(Common sunflower), complete
Length = 1623
Score = 99.6 bits (50), Expect = 1e-20
Identities = 158/194 (81%)
Strand = Plus / Plus
Query: 1 atgcagatcttcgtgaaaaccctgaccggcaagaccatcaccctcgaggtggagtcaagc 60
||||| ||||| || || ||||| || || |||||||||||||| |||||||||
Sbjct: 1244 atgcaaatctttgtcaagaccctcactggaaagaccatcacccttgaggtggagagttct 1303
Query: 61 gacaccatcgacaacgtcaaagcgaagatccaggacaaagaagggattccaccggaccag 120
||||||||||||||||| || || || || || ||||||||||| |||||||| |||||
Sbjct: 1304 gacaccatcgacaacgtgaaggctaaaattcaagacaaagaaggcattccaccagaccaa 1363
Query: 121 cagaggttgatcttcgccgggaagcagcttgaggatggccgtaccctcgccgattacaac 180
|||||| | ||||| || || || ||||||||||||||| | || | || |||||||||
Sbjct: 1364 cagaggctcatctttgctggcaaacagcttgaggatggcagaactttggctgattacaac 1423
Query: 181 atccagaaagagtc 194
|| |||||||||||
Sbjct: 1424 attcagaaagagtc 1437
Score = 85.7 bits (43), Expect = 2e-16
Identities = 181/227 (79%)
Strand = Plus / Plus
Query: 1 atgcagatcttcgtgaaaaccctgaccggcaagaccatcaccctcgaggtggagtcaagc 60
||||||||||| ||||| || |||| || |||||||||||||| |||||||||
Sbjct: 332 atgcagatctttgtgaagacattgactggaaagaccatcacccttgaggtggagagctct 391
Query: 61 gacaccatcgacaacgtcaaagcgaagatccaggacaaagaagggattccaccggaccag 120
|||||||| ||||| || || || ||||| ||||||||||| || || || || ||||||
Sbjct: 392 gacaccattgacaatgttaaggccaagattcaggacaaagagggcatccctccagaccag 451
Query: 121 cagaggttgatcttcgccgggaagcagcttgaggatggccgtaccctcgccgattacaac 180
|||||| | || ||||| || || ||||||||||||| | | || | || |||||||||
Sbjct: 452 cagaggctcatattcgctggcaaacagcttgaggatgacagaacattggctgattacaac 511
Query: 181 atccagaaagagtcaaccttgcatcttgttttgaggcttcgtggtgg 227
|| ||||||||||| ||| | || ||||| ||| | || ||||||||
Sbjct: 512 attcagaaagagtccaccctccaccttgtgttgcgactccgtggtgg 558
Score = 77.8 bits (39), Expect = 5e-14
Identities = 81/95 (85%)
Strand = Plus / Plus
Query: 100 gaagggattccaccggaccagcagaggttgatcttcgccgggaagcagcttgaggatggc 159
|||||||| ||||||||||||||| | | || || || || |||||||| ||||||||
Sbjct: 203 gaagggatcccaccggaccagcagcgtctcatttttgctggcaagcagctggaggatggg 262
Query: 160 cgtaccctcgccgattacaacatccagaaagagtc 194
|||||||| || |||||||||||||| ||||||||
Sbjct: 263 cgtacccttgctgattacaacatccaaaaagagtc 297
Score = 61.9 bits (31), Expect = 3e-09
Identities = 88/107 (82%)
Strand = Plus / Plus
Query: 88 atccaggacaaagaagggattccaccggaccagcagaggttgatcttcgccgggaagcag 147
|||||||| || || || ||||| || |||||||| |||||||| || || || |||||
Sbjct: 1103 atccaggataaggagggtattcccccagaccagcaaaggttgatttttgctggaaagcaa 1162
Query: 148 cttgaggatggccgtaccctcgccgattacaacatccagaaagagtc 194
||||| ||||| ||||| || || || |||||||| |||||||||||
Sbjct: 1163 cttgaagatggacgtactctggctgactacaacattcagaaagagtc 1209
Score = 60.0 bits (30), Expect = 1e-08
Identities = 45/50 (90%)
Strand = Plus / Plus
Query: 148 cttgaggatggccgtaccctcgccgattacaacatccagaaagagtcaac 197
|||||||||||||| || || || ||||| ||||||||||||||||||||
Sbjct: 935 cttgaggatggccgaactctggcagattataacatccagaaagagtcaac 984
Score = 58.0 bits (29), Expect = 4e-08
Identities = 83/101 (82%)
Strand = Plus / Plus
Query: 94 gacaaagaagggattccaccggaccagcagaggttgatcttcgccgggaagcagcttgag 153
|||||||| || || ||||| ||||| |||||| | ||||| || || || ||||||||
Sbjct: 653 gacaaagagggcatcccaccagaccaacagaggctcatctttgctggtaaacagcttgaa 712
Query: 154 gatggccgtaccctcgccgattacaacatccagaaagagtc 194
|||||| | ||| | ||||| |||||||| |||||||||||
Sbjct: 713 gatggcagaaccttggccgactacaacattcagaaagagtc 753
>gnl|LJGI|TC80080 UniRef100_A1X1E5 Cluster: Polyubiquitin; n=1; Thlaspi
caerulescens|Rep: Polyubiquitin - Thlaspi caerulescens
(Alpine penny-cress) (Thlaspi calaminare), partial (35%)
Length = 523
Score = 83.8 bits (42), Expect = 7e-16
Identities = 129/158 (81%)
Strand = Plus / Plus
Query: 1 atgcagatcttcgtgaaaaccctgaccggcaagaccatcaccctcgaggtggagtcaagc 60
||||||||||| || || || |||| || || ||||||||||| ||||| |||||
Sbjct: 352 atgcagatctttgttaagactttgactgggaaaaccatcacccttgaggttgagtcctcg 411
Query: 61 gacaccatcgacaacgtcaaagcgaagatccaggacaaagaagggattccaccggaccag 120
|||||||| ||||| ||||| |||||||||||||| ||||| || || || || || |||
Sbjct: 412 gacaccattgacaatgtcaaggcgaagatccaggataaagagggcatccctccagatcag 471
Query: 121 cagaggttgatcttcgccgggaagcagcttgaggatgg 158
||||||||||| || || ||||| || |||||||||||
Sbjct: 472 cagaggttgatttttgctgggaaacaacttgaggatgg 509
Score = 75.8 bits (38), Expect = 2e-13
Identities = 146/182 (80%)
Strand = Plus / Plus
Query: 1 atgcagatcttcgtgaaaaccctgaccggcaagaccatcaccctcgaggtggagtcaagc 60
|||||||| || |||||||| || |||||||||||||| ||||| ||||||||
Sbjct: 124 atgcagatttttgtgaaaactctcaccggcaagaccattacccttgaggtggaaagttca 183
Query: 61 gacaccatcgacaacgtcaaagcgaagatccaggacaaagaagggattccaccggaccag 120
|| ||||| ||||| || |||||||| ||||| ||||| |||||||| ||||| || |||
Sbjct: 184 gataccattgacaatgttaaagcgaaaatccaagacaaggaagggatcccacctgatcag 243
Query: 121 cagaggttgatcttcgccgggaagcagcttgaggatggccgtaccctcgccgattacaac 180
|| ||| | ||||| || || ||||| | |||||||| || ||||| || |||||||||
Sbjct: 244 caaaggcttatctttgctggtaagcaattggaggatggtcgcacccttgctgattacaac 303
Query: 181 at 182
||
Sbjct: 304 at 305
>gnl|LJGI|BW623042 UniRef100_A1X1E5 Cluster: Polyubiquitin; n=1; Thlaspi
caerulescens|Rep: Polyubiquitin - Thlaspi caerulescens
(Alpine penny-cress) (Thlaspi calaminare), partial (32%)
Length = 471
Score = 75.8 bits (38), Expect = 2e-13
Identities = 146/182 (80%)
Strand = Plus / Plus
Query: 1 atgcagatcttcgtgaaaaccctgaccggcaagaccatcaccctcgaggtggagtcaagc 60
|||||||| || |||||||| || |||||||||||||| ||||| ||||||||
Sbjct: 101 atgcagatttttgtgaaaactctcaccggcaagaccattacccttgaggtggaaagttca 160
Query: 61 gacaccatcgacaacgtcaaagcgaagatccaggacaaagaagggattccaccggaccag 120
|| ||||| ||||| || |||||||| ||||| ||||| |||||||| ||||| || |||
Sbjct: 161 gataccattgacaatgttaaagcgaaaatccaagacaaggaagggatcccacctgatcag 220
Query: 121 cagaggttgatcttcgccgggaagcagcttgaggatggccgtaccctcgccgattacaac 180
|| ||| | ||||| || || ||||| | |||||||| || ||||| || |||||||||
Sbjct: 221 caaaggcttatctttgctggtaagcaattggaggatggtcgcacccttgctgattacaac 280
Query: 181 at 182
||
Sbjct: 281 at 282
Score = 69.9 bits (35), Expect = 1e-11
Identities = 107/131 (81%)
Strand = Plus / Plus
Query: 1 atgcagatcttcgtgaaaaccctgaccggcaagaccatcaccctcgaggtggagtcaagc 60
||||||||||| || || || |||| || || ||||||||||| ||||| |||||
Sbjct: 329 atgcagatctttgttaagactttgactgggaaaaccatcacccttgaggttgagtcctcg 388
Query: 61 gacaccatcgacaacgtcaaagcgaagatccaggacaaagaagggattccaccggaccag 120
|||||||| ||||| ||||| |||||||||||||| ||||| || || || || || |||
Sbjct: 389 gacaccattgacaatgtcaaggcgaagatccaggataaagagggcatccctccagatcag 448
Query: 121 cagaggttgat 131
|||||||||||
Sbjct: 449 cagaggttgat 459
>gnl|LJGI|TC81636 UniRef100_A4US66 Cluster: Ubiquitin B; n=2; Coelomata|Rep:
Ubiquitin B - Sus scrofa (Pig), partial (72%)
Length = 566
Score = 73.8 bits (37), Expect = 7e-13
Identities = 94/113 (83%)
Strand = Plus / Plus
Query: 1 atgcagatcttcgtgaaaaccctgaccggcaagaccatcaccctcgaggtggagtcaagc 60
||||| |||||||| ||||| || || ||||| || ||||| |||||||| || |||||
Sbjct: 228 atgcaaatcttcgtcaaaacactcacaggcaaaacaatcacgctcgaggtcgaaccaagc 287
Query: 61 gacaccatcgacaacgtcaaagcgaagatccaggacaaagaagggattccacc 113
||||| ||||| |||||||||||||| || || || || ||||| ||||||||
Sbjct: 288 gacacgatcgaaaacgtcaaagcgaaaattcaagataaggaaggtattccacc 340
>gnl|LJGI|FS360056 homologue to UniRef100_A3LZJ4 Cluster: Predicted protein; n=7;
Eukaryota|Rep: Predicted protein - Pichia stipitis
(Yeast), partial (62%)
Length = 691
Score = 71.9 bits (36), Expect = 3e-12
Identities = 93/111 (83%), Gaps = 2/111 (1%)
Strand = Plus / Minus
Query: 84 gaagatccaggacaaagaagggattccaccggaccagcagaggttgatcttcgccgggaa 143
|||||| |||||||| || || |||||||||||||||||| | ||||| || || || ||
Sbjct: 268 gaagattcaggacaaggagggcattccaccggaccagcagcgattgatttttgcaggaaa 209
Query: 144 gcagcttgaggatggccgtaccctcgccgattacaacatccagaaagagtc 194
|||||| |||||||| || ||| | | ||||||||||| |||||||||||
Sbjct: 208 gcagctggaggatgggcgcacctt--ctgattacaacattcagaaagagtc 160
>gnl|LJGI|TC81524 homologue to UniRef100_A1X1E5 Cluster: Polyubiquitin; n=1; Thlaspi
caerulescens|Rep: Polyubiquitin - Thlaspi caerulescens
(Alpine penny-cress) (Thlaspi calaminare), partial (15%)
Length = 382
Score = 69.9 bits (35), Expect = 1e-11
Identities = 47/51 (92%)
Strand = Plus / Minus
Query: 108 tccaccggaccagcagaggttgatcttcgccgggaagcagcttgaggatgg 158
||||||||||||||||||||||||||| || ||||||||| | ||||||||
Sbjct: 64 tccaccggaccagcagaggttgatctttgcagggaagcagttggaggatgg 14
>gnl|LJGI|TC81522 homologue to UniRef100_A1X1E5 Cluster: Polyubiquitin; n=1; Thlaspi
caerulescens|Rep: Polyubiquitin - Thlaspi caerulescens
(Alpine penny-cress) (Thlaspi calaminare), partial (41%)
Length = 617
Score = 69.9 bits (35), Expect = 1e-11
Identities = 98/119 (82%)
Strand = Plus / Plus
Query: 85 aagatccaggacaaagaagggattccaccggaccagcagaggttgatcttcgccgggaag 144
||||| |||||||| || || || || ||||||||||||||| | |||||||| |||||
Sbjct: 311 aagattcaggacaaggagggcatccctccggaccagcagaggctcatcttcgctgggaaa 370
Query: 145 cagcttgaggatggccgtaccctcgccgattacaacatccagaaagagtcaaccttgca 203
|| ||||||||||| | ||||| || || || ||||||||||| ||||| ||| ||||
Sbjct: 371 caacttgaggatggaaggacccttgctgactataacatccagaaggagtctaccctgca 429
Score = 63.9 bits (32), Expect = 7e-10
Identities = 86/104 (82%)
Strand = Plus / Plus
Query: 1 atgcagatcttcgtgaaaaccctgaccggcaagaccatcaccctcgaggtggagtcaagc 60
||||| ||||||||||||||||| ||||| ||||| ||||| |||||||| |||
Sbjct: 85 atgcaaatcttcgtgaaaaccctaaccgggaagacaatcactctcgaggtagagagttca 144
Query: 61 gacaccatcgacaacgtcaaagcgaagatccaggacaaagaagg 104
|| ||||| ||||||| ||||| |||||||| |||||||||||
Sbjct: 145 gataccattaacaacgtgaaagctaagatccaagacaaagaagg 188
>gnl|LJGI|AV422262 UniRef100_A0MKC8 Cluster: Ubiquitin extension protein; n=2; core
eudicotyledons|Rep: Ubiquitin extension protein -
Capsicum annuum (Bell pepper), partial (17%)
Length = 148
Score = 61.9 bits (31), Expect = 3e-09
Identities = 69/78 (88%), Gaps = 4/78 (5%)
Strand = Plus / Plus
Query: 85 aagatccaggacaaagaagggattccaccgg-accagcagaggtt--gatcttcgccggg 141
||||||||||| || || |||||||| |||| ||||||||||| | |||||||||||||
Sbjct: 4 aagatccaggataaggaggggattcccccgggaccagcagagggttggatcttcgccggg 63
Query: 142 aa-gcagcttgaggatgg 158
|| |||||||||||||||
Sbjct: 64 aaagcagcttgaggatgg 81