Miyakogusa Predicted Gene

Lj1g3v0968890.1

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj1g3v0968890.1 Non Chatacterized Hit- tr|B9T875|B9T875_RICCO
Putative uncharacterized protein OS=Ricinus communis
G,66.15,8e-18,DUF3475,Protein of unknown function DUF3475; SUBFAMILY
NOT NAMED,NULL; FAMILY NOT
NAMED,NULL,NODE_93565_length_144_cov_10.638889.path1.1
         (196 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC63291 weakly similar to UniRef100_A7QBH5 Cluster: Chr...   278   1e-74
gnl|LJGI|BW624964 weakly similar to UniRef100_A7QBH5 Cluster: Ch...   155   1e-37
gnl|LJGI|TC63107 weakly similar to UniRef100_A7QBH5 Cluster: Chr...   151   2e-36
gnl|LJGI|TC73227                                                       52   1e-06

>gnl|LJGI|TC63291 weakly similar to UniRef100_A7QBH5 Cluster: Chromosome chr13
           scaffold_74, whole genome shotgun sequence; n=1; Vitis
           vinifera|Rep: Chromosome chr13 scaffold_74, whole genome
           shotgun sequence - Vitis vinifera (Grape), partial (29%)
          Length = 750

 Score =  278 bits (140), Expect = 1e-74
 Identities = 182/196 (92%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgtccaaggtggttaatttatggcaatcattgagtgataaacagattgctaggttgaga 60
           |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||  
Sbjct: 292 atgtccaaggtggttaatttatggcaatcattgagtgataaacagattgctatgttgaag 351

                                                                       
Query: 61  gaggagaccactgattcaattggcctaagaaagcttatttcagatgatgagaatttcatt 120
           ||||||| |||  ||||||||||| ||||||||||| |||||||||||||   |||||||
Sbjct: 352 gaggagatcaccaattcaattggcataagaaagcttgtttcagatgatgatcttttcatt 411

                                                                       
Query: 121 gtacgcttgatctgtgtagagaaacttgagaatatggcacatgtggcagagtccgtggct 180
           | |||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||
Sbjct: 412 gaacgcttgatctgtgtagagatacttgagaatatggcacatgtggccgagtccgtggct 471

                           
Query: 181 aggcttgggaagaaat 196
           ||||||||||||||||
Sbjct: 472 aggcttgggaagaaat 487


>gnl|LJGI|BW624964 weakly similar to UniRef100_A7QBH5 Cluster: Chromosome chr13
           scaffold_74, whole genome shotgun sequence; n=1; Vitis
           vinifera|Rep: Chromosome chr13 scaffold_74, whole genome
           shotgun sequence - Vitis vinifera (Grape), partial (11%)
          Length = 483

 Score =  155 bits (78), Expect = 1e-37
 Identities = 162/190 (85%)
 Strand = Plus / Plus

                                                                       
Query: 7   aaggtggttaatttatggcaatcattgagtgataaacagattgctaggttgagagaggag 66
           ||||||||||||||||||||||||||||||||||||||||||  ||  |||||| |||||
Sbjct: 205 aaggtggttaatttatggcaatcattgagtgataaacagatttttaaattgagaaaggag 264

                                                                       
Query: 67  accactgattcaattggcctaagaaagcttatttcagatgatgagaatttcattgtacgc 126
           | |||  ||||| ||||| ||||||||||| |||| | ||||||| ||||||||   || 
Sbjct: 265 atcaccaattcatttggcataagaaagcttgtttctggtgatgagtatttcattaaccgt 324

                                                                       
Query: 127 ttgatctgtgtagagaaacttgagaatatggcacatgtggcagagtccgtggctaggctt 186
           |||||||||| ||||  || ||||||| ||||||||||||| || || |||||| ||| |
Sbjct: 325 ttgatctgtgcagagttacatgagaatttggcacatgtggctgactctgtggcttggcat 384

                     
Query: 187 gggaagaaat 196
           ||||||||||
Sbjct: 385 gggaagaaat 394


>gnl|LJGI|TC63107 weakly similar to UniRef100_A7QBH5 Cluster: Chromosome chr13
           scaffold_74, whole genome shotgun sequence; n=1; Vitis
           vinifera|Rep: Chromosome chr13 scaffold_74, whole genome
           shotgun sequence - Vitis vinifera (Grape), partial (34%)
          Length = 787

 Score =  151 bits (76), Expect = 2e-36
 Identities = 166/196 (84%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgtccaaggtggttaatttatggcaatcattgagtgataaacagattgctaggttgaga 60
           ||||||||| | |||||||| ||||| || |||||||| |||||| ||||||||||||||
Sbjct: 243 atgtccaagcttgttaatttgtggcagtctttgagtgagaaacaggttgctaggttgaga 302

                                                                       
Query: 61  gaggagaccactgattcaattggcctaagaaagcttatttcagatgatgagaatttcatt 120
           ||||||| |||  ||||| | ||  | |  |||||| |||||||||||||||||||| ||
Sbjct: 303 gaggagatcacaaattcagtgggtatcaagaagcttgtttcagatgatgagaatttcgtt 362

                                                                       
Query: 121 gtacgcttgatctgtgtagagaaacttgagaatatggcacatgtggcagagtccgtggct 180
           ||||| || ||| || ||||||  ||||||||||| ||||||||||| || || ||||||
Sbjct: 363 gtacgtttaatcagtctagagatgcttgagaatattgcacatgtggctgaatctgtggct 422

                           
Query: 181 aggcttgggaagaaat 196
           ||||| ||||||||||
Sbjct: 423 aggctcgggaagaaat 438


>gnl|LJGI|TC73227 
          Length = 752

 Score = 52.0 bits (26), Expect = 1e-06
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                             
Query: 147 tgagaatatggcacatgtggcagagtccgtggctaggcttgggaagaaat 196
           ||||||| ||||||||||||| || || |||||| ||| |||||||||||
Sbjct: 302 tgagaatttggcacatgtggctgactctgtggcttggcatgggaagaaat 351