Miyakogusa Predicted Gene

Lj1g3v0898880.2
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj1g3v0898880.2 Non Chatacterized Hit- tr|I1LKM2|I1LKM2_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.45889 PE,41.67,0.000001,
,CUFF.26500.2
         (360 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC77387 similar to UniRef100_Q2HVX8 Cluster: Helix-loop...    78   4e-14

>gnl|LJGI|TC77387 similar to UniRef100_Q2HVX8 Cluster: Helix-loop-helix DNA-binding;
           n=2; Medicago truncatula|Rep: Helix-loop-helix
           DNA-binding - Medicago truncatula (Barrel medic),
           partial (17%)
          Length = 899

 Score = 77.8 bits (39), Expect = 4e-14
 Identities = 63/71 (88%)
 Strand = Plus / Plus

                                                                       
Query: 289 tcaccaattttcagctggaatgcagacagtagctgttattcatgtgcttccccatggggt 348
           ||||||| ||||||||||||||||||||||||| ||||||| |||||| || || || ||
Sbjct: 779 tcaccaaatttcagctggaatgcagacagtagcagttattcctgtgctgcctcacggcgt 838

                      
Query: 349 tgtccaacttg 359
           ||| |||||||
Sbjct: 839 tgttcaacttg 849