Miyakogusa Predicted Gene

Lj1g3v0874150.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj1g3v0874150.1 tr|G7LH81|G7LH81_MEDTR Cyclin A OS=Medicago
truncatula GN=MTR_8g095860 PE=3 SV=1,78.4,0,Cyclin_N,Cyclin,
N-terminal; Cyclin_C,Cyclin, C-terminal; CYCLIN-A,NULL; CYCLINE,NULL;
CYCLINS,Cycli,CUFF.26440.1
         (1026 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC58991 homologue to UniRef100_Q39879 Cluster: Mitotic ...    78   1e-13

>gnl|LJGI|TC58991 homologue to UniRef100_Q39879 Cluster: Mitotic cyclin a2-type; n=1;
           Glycine max|Rep: Mitotic cyclin a2-type - Glycine max
           (Soybean), partial (49%)
          Length = 872

 Score = 77.8 bits (39), Expect = 1e-13
 Identities = 168/211 (79%)
 Strand = Plus / Plus

                                                                       
Query: 346 tggcttgtggaggttactgaagagtataggcttctacctgatacactatttttggcagtt 405
           ||||||||||||||  ||||||||||||| ||  ||||||||||| | | |||| |||| 
Sbjct: 33  tggcttgtggaggtggctgaagagtatagactagtacctgatacattgtatttgacagta 92

                                                                       
Query: 406 aactacattgatcgatatctttcgggcaaggcaataattcagcagcgattacaactactt 465
           |||| ||| ||||| ||||| || || || ||||| |    |||    |||||| |||||
Sbjct: 93  aactgcatagatcggtatctctcagggaatgcaatgagcaggcaaaagttacaattactt 152

                                                                       
Query: 466 ggtgttgcctgcatgatgattgctgccaaatacgaggagatttgtgcccctaaggcggaa 525
           || ||||||| ||||||||||||  | ||||| |||||||||||||| ||| ||| ||| 
Sbjct: 153 ggggttgcctccatgatgattgcctcgaaatatgaggagatttgtgcacctcaggtggag 212

                                          
Query: 526 gatttctgttacgtgactgataatacatact 556
           || || |||||| | ||||| || |||||||
Sbjct: 213 gaattttgttacataactgacaacacatact 243



 Score = 56.0 bits (28), Expect = 4e-07
 Identities = 52/60 (86%)
 Strand = Plus / Plus

                                                                        
Query: 943  aaatacagtcaacataagttcaagtttgtagcaaagaagtattgccctccatcaatacct 1002
            |||||||||||||| |||| ||| | ||| || |||||||| |||||||| |||||||||
Sbjct: 633  aaatacagtcaacacaagtacaaatatgtggccaagaagtactgccctccttcaatacct 692