Miyakogusa Predicted Gene

Lj1g3v0872960.1

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj1g3v0872960.1 Non Chatacterized Hit- tr|I1N523|I1N523_SOYBN
Uncharacterized protein OS=Glycine max PE=4 SV=1,48.74,2e-19,no
description,NULL; SUBFAMILY NOT NAMED,NULL; CATION EFFLUX PROTEIN/
ZINC TRANSPORTER,Cation efflux,CUFF.26467.1
         (366 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC63118 similar to UniRef100_Q84ND6 Cluster: Cation dif...   345   1e-94
gnl|LJGI|GO012918 similar to UniRef100_Q84ND6 Cluster: Cation di...   125   2e-28

>gnl|LJGI|TC63118 similar to UniRef100_Q84ND6 Cluster: Cation diffusion facilitator
           8; n=1; Stylosanthes hamata|Rep: Cation diffusion
           facilitator 8 - Stylosanthes hamata (Caribbean stylo),
           partial (90%)
          Length = 1439

 Score =  345 bits (174), Expect = 1e-94
 Identities = 273/306 (89%)
 Strand = Plus / Plus

                                                                       
Query: 49  gaacaggctcaacaagaaagagcaatgaagattttcaattatgcaaatgttgctctcttg 108
           |||||||||||||||||  | |||||||||||||  ||||| || |||||||||||||||
Sbjct: 461 gaacaggctcaacaagagtgggcaatgaagatttcaaattacgccaatgttgctctcttg 520

                                                                       
Query: 109 gcattaaagatttgtgccacagtaaggagtggttcaatggctattggagcatcaactttg 168
             ||| ||||||| ||||||| |||||||||| ||||| ||||||| |||||||||||||
Sbjct: 521 atattgaagatttatgccacattaaggagtgggtcaatagctattgcagcatcaactttg 580

                                                                       
Query: 169 gattctttgcttgatctcatggctgggggcatactttggttcactcacgtctcaatgaag 228
           |||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||
Sbjct: 581 gattctttgcttgatctcatggctggtggcatactctggttcactcacgtctcaatgaag 640

                                                                       
Query: 229 aaaaacaatatctacaagaaccccattggaaagctcagggtgcagccagtgggcataatt 288
           || | ||||||||||||| |||||||||||||| | ||||||||||| ||||| ||||| 
Sbjct: 641 aacatcaatatctacaagtaccccattggaaagttgagggtgcagcctgtgggtataatc 700

                                                                       
Query: 289 atctttgttgcaatcatggcaacacttggctttcaggtgttaatcacagccttacaacaa 348
            ||||||  || ||||||||||||||||| ||||||||| ||||||||||| |||| |||
Sbjct: 701 gtctttgcggccatcatggcaacacttggatttcaggtgctaatcacagccgtacagcaa 760

                 
Query: 349 ctaata 354
           ||||||
Sbjct: 761 ctaata 766


>gnl|LJGI|GO012918 similar to UniRef100_Q84ND6 Cluster: Cation diffusion facilitator
           8; n=1; Stylosanthes hamata|Rep: Cation diffusion
           facilitator 8 - Stylosanthes hamata (Caribbean stylo),
           partial (35%)
          Length = 781

 Score =  125 bits (63), Expect = 2e-28
 Identities = 222/275 (80%)
 Strand = Plus / Plus

                                                                       
Query: 50  aacaggctcaacaagaaagagcaatgaagattttcaattatgcaaatgttgctctcttgg 109
           ||||||||||||| ||| |||||||||||||||  |||||||||||||  | | |  |||
Sbjct: 397 aacaggctcaacatgaacgagcaatgaagatttctaattatgcaaatgcagttttactgg 456

                                                                       
Query: 110 cattaaagatttgtgccacagtaaggagtggttcaatggctattggagcatcaactttgg 169
            ||||||||||| ||  |   |||||| ||| || |||||| | |  ||||| || ||||
Sbjct: 457 tattaaagatttatgtgatgataaggactggatcgatggctgtcgcggcatcgacattgg 516

                                                                       
Query: 170 attctttgcttgatctcatggctgggggcatactttggttcactcacgtctcaatgaaga 229
           ||||| |||||||  |||||||||| ||||| ||||||||||||||| |  |||||||||
Sbjct: 517 attctctgcttgacttcatggctggtggcattctttggttcactcaccttgcaatgaaga 576

                                                                       
Query: 230 aaaacaatatctacaagaaccccattggaaagctcagggtgcagccagtgggcataatta 289
           | |  || || || ||  |||| ||||||||| | ||| |||||||||||||||||||  
Sbjct: 577 acataaacatgtataaataccctattggaaagttgaggatgcagccagtgggcataatcg 636

                                              
Query: 290 tctttgttgcaatcatggcaacacttggctttcag 324
           ||||||  ||  |||||||||||||||| ||||||
Sbjct: 637 tctttgcagctgtcatggcaacacttggttttcag 671