Miyakogusa Predicted Gene

Lj1g3v0715560.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj1g3v0715560.1 Non Chatacterized Hit- tr|I1JCE0|I1JCE0_SOYBN
Uncharacterized protein (Fragment) OS=Glycine max
PE=3,81.27,0,Asp,Peptidase A1; ASP_PROTEASE,Peptidase aspartic, active
site; Acid proteases,Peptidase aspartic; C,CUFF.26205.1
         (1548 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC77261 weakly similar to UniRef100_A7R111 Cluster: Chr...    54   3e-06

>gnl|LJGI|TC77261 weakly similar to UniRef100_A7R111 Cluster: Chromosome chr4
           scaffold_333, whole genome shotgun sequence; n=1; Vitis
           vinifera|Rep: Chromosome chr4 scaffold_333, whole genome
           shotgun sequence - Vitis vinifera (Grape), partial (43%)
          Length = 1925

 Score = 54.0 bits (27), Expect = 3e-06
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 799 atgtgttttggacgcgatggtattggaagaataagttttggggacaa 845
           |||||||||||||  |||||| |||||||||| | ||||||||||||
Sbjct: 925 atgtgttttggacctgatggtcttggaagaatcacttttggggacaa 971