Miyakogusa Predicted Gene

Lj1g3v0672350.3
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj1g3v0672350.3 Non Chatacterized Hit- tr|I1LMG8|I1LMG8_SOYBN
Uncharacterized protein OS=Glycine max PE=3
SV=1,85.37,0,CULLIN_2,Cullin homology; seg,NULL; Cullin,Cullin,
N-terminal; APC2,Anaphase-promoting complex subun,CUFF.26174.3
         (1236 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|DC595061 similar to UniRef100_UPI0000EAFF85 Cluster: Co...    60   3e-08
gnl|LJGI|TC74795 similar to UniRef100_Q58Y94 Cluster: NADH-ubiqu...    58   1e-07

>gnl|LJGI|DC595061 similar to UniRef100_UPI0000EAFF85 Cluster: Contactin-2 precursor
           (Axonin-1) (Axonal glycoprotein TAG-1), partial (1%)
          Length = 236

 Score = 60.0 bits (30), Expect = 3e-08
 Identities = 59/71 (83%)
 Strand = Plus / Plus

                                                                       
Query: 618 atttaatgaaatcaaaacacctcgtaagctacagtggnnnnnnngtcttgggaccgttaa 677
           |||||||||||||| ||||||| |||| |||||||||       ||||||||| | ||||
Sbjct: 163 atttaatgaaatcacaacaccttgtaacctacagtggaaaaaaagtcttgggaaccttaa 222

                      
Query: 678 gctggagttgc 688
           |||||||||||
Sbjct: 223 gctggagttgc 233


>gnl|LJGI|TC74795 similar to UniRef100_Q58Y94 Cluster: NADH-ubiquinone oxidoreductase
            chain 3; n=1; Geobates poeciloptera|Rep: NADH-ubiquinone
            oxidoreductase chain 3 - Geobates poeciloptera, partial
            (18%)
          Length = 538

 Score = 58.0 bits (29), Expect = 1e-07
 Identities = 29/29 (100%)
 Strand = Plus / Plus

                                         
Query: 1208 atggaatgtacactccaaagaagtagtgg 1236
            |||||||||||||||||||||||||||||
Sbjct: 1    atggaatgtacactccaaagaagtagtgg 29