Miyakogusa Predicted Gene

Lj1g3v0416410.3

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj1g3v0416410.3 Non Chatacterized Hit- tr|I1LX15|I1LX15_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.42516 PE,64.71,0.00003,
,CUFF.25850.3
         (237 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC81958 similar to UniRef100_Q8LB17 Cluster: Uncharacte...   157   4e-38
gnl|LJGI|TC64870 weakly similar to UniRef100_A7PAL1 Cluster: Chr...   127   3e-29
gnl|LJGI|TC79678                                                      100   7e-21
gnl|LJGI|BP080098 similar to UniRef100_Q8LB17 Cluster: Uncharact...    50   6e-06

>gnl|LJGI|TC81958 similar to UniRef100_Q8LB17 Cluster: Uncharacterized protein
           At3g58460; n=1; Arabidopsis thaliana|Rep:
           Uncharacterized protein At3g58460 - Arabidopsis thaliana
           (Mouse-ear cress), partial (6%)
          Length = 607

 Score =  157 bits (79), Expect = 4e-38
 Identities = 79/79 (100%)
 Strand = Plus / Plus

                                                                       
Query: 159 tgtttgtagttgtaggtgcttttctgtccccttttcgattgattttaggcatgtcactca 218
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   tgtttgtagttgtaggtgcttttctgtccccttttcgattgattttaggcatgtcactca 60

                              
Query: 219 gagtacgttttcacaatga 237
           |||||||||||||||||||
Sbjct: 61  gagtacgttttcacaatga 79


>gnl|LJGI|TC64870 weakly similar to UniRef100_A7PAL1 Cluster: Chromosome chr14
           scaffold_9, whole genome shotgun sequence; n=1; Vitis
           vinifera|Rep: Chromosome chr14 scaffold_9, whole genome
           shotgun sequence - Vitis vinifera (Grape), partial (9%)
          Length = 713

 Score =  127 bits (64), Expect = 3e-29
 Identities = 96/106 (90%), Gaps = 3/106 (2%)
 Strand = Plus / Plus

                                                                       
Query: 15  agacatcaaagtacaagaaggggatggtactgc---atttgatgaaagatggtctgttta 71
           |||||||||||||||||||||||||||||||||   |  ||||||||| |||| | ||||
Sbjct: 367 agacatcaaagtacaagaaggggatggtactgctgcaactgatgaaaggtggttttttta 426

                                                         
Query: 72  tggtcctgagaagaagaatgagattgataagtatatttcttcaagg 117
           ||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 427 tggtcctgagaagaagaatgacattgataagtacatttcttcaagg 472


>gnl|LJGI|TC79678 
          Length = 669

 Score = 99.6 bits (50), Expect = 7e-21
 Identities = 95/108 (87%), Gaps = 4/108 (3%)
 Strand = Plus / Plus

                                                                       
Query: 14  cagacatcaaagtaca-agaaggggatggtactgc---atttgatgaaagatggtctgtt 69
           |||||||| ||||||  ||||||||||||||||||   |  ||||||||| |||| | ||
Sbjct: 346 cagacatccaagtacccagaaggggatggtactgctgcaactgatgaaaggtggtttttt 405

                                                           
Query: 70  tatggtcctgagaagaagaatgagattgataagtatatttcttcaagg 117
           ||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 406 tatggtcctgagaagaagaatgacattgataagtacatttcttcaagg 453


>gnl|LJGI|BP080098 similar to UniRef100_Q8LB17 Cluster: Uncharacterized protein
           At3g58460; n=1; Arabidopsis thaliana|Rep:
           Uncharacterized protein At3g58460 - Arabidopsis thaliana
           (Mouse-ear cress), partial (6%)
          Length = 384

 Score = 50.1 bits (25), Expect = 6e-06
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 213 cactcagagtacgttttcacaatga 237
           |||||||||||||||||||||||||
Sbjct: 384 cactcagagtacgttttcacaatga 360