Miyakogusa Predicted Gene

Lj1g3v0415850.2
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj1g3v0415850.2 Non Chatacterized Hit- tr|C6T147|C6T147_SOYBN
Putative uncharacterized protein OS=Glycine max PE=2
S,57.14,0.000000006, ,CUFF.25795.2
         (339 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|DC596861 weakly similar to UniRef100_A1ARP5 Cluster: Ca...   204   3e-52
gnl|LJGI|TC58001 similar to UniRef100_Q944H2 Cluster: AT3g21580/...   103   7e-22
gnl|LJGI|TC63391 similar to UniRef100_A9SGF1 Cluster: Predicted ...    84   6e-16
gnl|LJGI|TC57256 similar to UniRef100_A9SGF1 Cluster: Predicted ...    84   6e-16

>gnl|LJGI|DC596861 weakly similar to UniRef100_A1ARP5 Cluster: Carboxyl-terminal
           protease precursor; n=1; Pelobacter propionicus DSM
           2379|Rep: Carboxyl-terminal protease precursor -
           Pelobacter propionicus (strain DSM 2379), partial (7%)
          Length = 571

 Score =  204 bits (103), Expect = 3e-52
 Identities = 178/202 (88%), Gaps = 7/202 (3%)
 Strand = Plus / Plus

                                                                       
Query: 68  tccagagcagaatgatggaggagcttcactcgcaagggtcaatgtcaatcagtgaattga 127
           |||| |||||||||||||||||||||||||||||||| |||||      |||||||||||
Sbjct: 214 tccacagcagaatgatggaggagcttcactcgcaaggatcaat------cagtgaattga 267

                                                                       
Query: 128 attggtctcagtggctcaccaccagctcttttgccgctgacaaagttttcagattcatag 187
           ||||||| |||||||||  |||||||||| || | |||| || |||||||||||||||||
Sbjct: 268 attggtcccagtggctccacaccagctctattcctgctg-catagttttcagattcatag 326

                                                                       
Query: 188 cgggttccacagctagcccttttggccactttgtattctccccactatgtttcttcgata 247
           ||||| ||||||| |||||||||||||| ||||||| |||||||||| ||||||||  ||
Sbjct: 327 cgggtgccacagccagcccttttggccattttgtatcctccccactacgtttcttcacta 386

                                 
Query: 248 tatcattccttgagtcaaattg 269
           ||||| ||||||||||||||||
Sbjct: 387 tatcagtccttgagtcaaattg 408


>gnl|LJGI|TC58001 similar to UniRef100_Q944H2 Cluster: AT3g21580/MIL23_14; n=1;
           Arabidopsis thaliana|Rep: AT3g21580/MIL23_14 -
           Arabidopsis thaliana (Mouse-ear cress), partial (76%)
          Length = 1233

 Score =  103 bits (52), Expect = 7e-22
 Identities = 85/96 (88%)
 Strand = Plus / Plus

                                                                       
Query: 128 attggtctcagtggctcaccaccagctcttttgccgctgacaaagttttcagattcatag 187
           ||||||| ||||||||| ||||| |||||||||| |||||||||||||||||||| ||||
Sbjct: 268 attggtcccagtggctccccaccggctcttttgctgctgacaaagttttcagattgatag 327

                                               
Query: 188 cgggttccacagctagcccttttggccactttgtat 223
           | ||| |||| ||||||||  ||||||| |||||||
Sbjct: 328 ccggtgccaccgctagccccattggccagtttgtat 363


>gnl|LJGI|TC63391 similar to UniRef100_A9SGF1 Cluster: Predicted protein; n=1;
           Physcomitrella patens subsp. patens|Rep: Predicted
           protein - Physcomitrella patens subsp. patens, partial
           (48%)
          Length = 782

 Score = 83.8 bits (42), Expect = 6e-16
 Identities = 57/62 (91%)
 Strand = Plus / Plus

                                                                       
Query: 17  ggttgggattggaaactatgattcattctatgagaagagaattgtttttactccagagca 76
           ||||| |||||||||||| |||||||||||||||||| || | |||||||||||||||||
Sbjct: 532 ggttgagattggaaactacgattcattctatgagaagggagtagtttttactccagagca 591

             
Query: 77  ga 78
           ||
Sbjct: 592 ga 593


>gnl|LJGI|TC57256 similar to UniRef100_A9SGF1 Cluster: Predicted protein; n=1;
           Physcomitrella patens subsp. patens|Rep: Predicted
           protein - Physcomitrella patens subsp. patens, partial
           (71%)
          Length = 1215

 Score = 83.8 bits (42), Expect = 6e-16
 Identities = 57/62 (91%)
 Strand = Plus / Plus

                                                                       
Query: 17  ggttgggattggaaactatgattcattctatgagaagagaattgtttttactccagagca 76
           ||||| |||||||||||| |||||||||||||||||| || | |||||||||||||||||
Sbjct: 472 ggttgagattggaaactacgattcattctatgagaagggagtagtttttactccagagca 531

             
Query: 77  ga 78
           ||
Sbjct: 532 ga 533