Miyakogusa Predicted Gene

Lj1g3v0409040.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj1g3v0409040.1 Non Chatacterized Hit- tr|I1JX78|I1JX78_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.50326
PE,74.16,0,SUBFAMILY NOT NAMED,NULL; FAMILY NOT NAMED,NULL;
ZF_DOF_2,Zinc finger, Dof-type; seg,NULL; zf-Dof,Zi,CUFF.25662.1
         (1032 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|BP080960 homologue to UniRef100_Q3R2H7 Cluster: Fimbria...   133   2e-30
gnl|LJGI|DC599565 similar to UniRef100_Q0GLD8 Cluster: Dof14; n=...   127   1e-28
gnl|LJGI|BP069051 similar to UniRef100_Q0GLD3 Cluster: Dof19; n=...   117   1e-25
gnl|LJGI|TC79148 homologue to UniRef100_Q0GLD5 Cluster: Dof17; n...   103   2e-21
gnl|LJGI|TC61491 similar to UniRef100_Q0GLD5 Cluster: Dof17; n=1...   103   2e-21
gnl|LJGI|TC59564 similar to UniRef100_Q76KV2 Cluster: DNA bindin...   101   8e-21
gnl|LJGI|TC66125 similar to UniRef100_Q0GLD5 Cluster: Dof17; n=1...    96   5e-19
gnl|LJGI|TC75151 similar to UniRef100_Q0GLC9 Cluster: Dof22; n=1...    92   8e-18
gnl|LJGI|TC59646 similar to UniRef100_Q0GLE2 Cluster: Dof10; n=1...    84   2e-15
gnl|LJGI|AW720051 similar to UniRef100_Q0GLE8 Cluster: Dof4; n=1...    78   1e-13
gnl|LJGI|FS336172 similar to UniRef100_Q0GLE5 Cluster: Dof7; n=1...    76   5e-13
gnl|LJGI|DC599444 homologue to UniRef100_Q0GLD5 Cluster: Dof17; ...    74   2e-12
gnl|LJGI|TC64822 similar to UniRef100_Q0GLF0 Cluster: Dof1; n=1;...    70   3e-11
gnl|LJGI|BP037378 similar to UniRef100_A7PIU8 Cluster: Chromosom...    66   5e-10
gnl|LJGI|TC72546 similar to UniRef100_Q76KU9 Cluster: DNA bindin...    62   7e-09
gnl|LJGI|DC599154 homologue to UniRef100_A7QPU1 Cluster: Chromos...    56   4e-07

>gnl|LJGI|BP080960 homologue to UniRef100_Q3R2H7 Cluster: Fimbrial assembly protein;
            n=2; Xylella fastidiosa|Rep: Fimbrial assembly protein -
            Xylella fastidiosa Ann-1, partial (7%)
          Length = 397

 Score =  133 bits (67), Expect = 2e-30
 Identities = 67/67 (100%)
 Strand = Plus / Minus

                                                                        
Query: 966  cggtccaggatcatggactggtggcatgatgaacggctatggatcctccacaaacccttt 1025
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 397  cggtccaggatcatggactggtggcatgatgaacggctatggatcctccacaaacccttt 338

                   
Query: 1026 gatctaa 1032
            |||||||
Sbjct: 337  gatctaa 331


>gnl|LJGI|DC599565 similar to UniRef100_Q0GLD8 Cluster: Dof14; n=1; Glycine max|Rep:
           Dof14 - Glycine max (Soybean), partial (12%)
          Length = 255

 Score =  127 bits (64), Expect = 1e-28
 Identities = 64/64 (100%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgggtttgtcttctcttcacgtttgcatggacacagcagagcattggttacagggcaca 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 192 atgggtttgtcttctcttcacgtttgcatggacacagcagagcattggttacagggcaca 251

               
Query: 61  attc 64
           ||||
Sbjct: 252 attc 255


>gnl|LJGI|BP069051 similar to UniRef100_Q0GLD3 Cluster: Dof19; n=1; Glycine max|Rep:
           Dof19 - Glycine max (Soybean), partial (44%)
          Length = 344

 Score =  117 bits (59), Expect = 1e-25
 Identities = 74/79 (93%)
 Strand = Plus / Minus

                                                                       
Query: 194 acaccaagttctgctactacaacaactacagcctctctcagcccaggtacttctgcaaga 253
           ||||| |||||||||||||||||||||| |||||| |||||||||||||||||||| |||
Sbjct: 267 acacccagttctgctactacaacaactatagcctcactcagcccaggtacttctgctaga 208

                              
Query: 254 cttgcagaaggtattggac 272
           ||||||||||||| |||||
Sbjct: 207 cttgcagaaggtactggac 189


>gnl|LJGI|TC79148 homologue to UniRef100_Q0GLD5 Cluster: Dof17; n=1; Glycine max|Rep:
           Dof17 - Glycine max (Soybean), partial (32%)
          Length = 813

 Score =  103 bits (52), Expect = 2e-21
 Identities = 88/100 (88%)
 Strand = Plus / Plus

                                                                       
Query: 194 acaccaagttctgctactacaacaactacagcctctctcagcccaggtacttctgcaaga 253
           |||||||||||||||| |||||||||||||||||| | || || || |||||||||||||
Sbjct: 419 acaccaagttctgctattacaacaactacagcctcacacaaccgagatacttctgcaaga 478

                                                   
Query: 254 cttgcagaaggtattggaccaagggaggaactctcagaaa 293
           | |||||||||||||||||  | |||||  ||||||||||
Sbjct: 479 catgcagaaggtattggacagaaggagggtctctcagaaa 518


>gnl|LJGI|TC61491 similar to UniRef100_Q0GLD5 Cluster: Dof17; n=1; Glycine max|Rep:
           Dof17 - Glycine max (Soybean), partial (46%)
          Length = 1290

 Score =  103 bits (52), Expect = 2e-21
 Identities = 88/100 (88%)
 Strand = Plus / Plus

                                                                       
Query: 194 acaccaagttctgctactacaacaactacagcctctctcagcccaggtacttctgcaaga 253
           |||||||||||||||| |||||||||||||||||| | || || || |||||||||||||
Sbjct: 207 acaccaagttctgctattacaacaactacagcctcacacaaccgagatacttctgcaaga 266

                                                   
Query: 254 cttgcagaaggtattggaccaagggaggaactctcagaaa 293
           | |||||||||||||||||  | |||||  ||||||||||
Sbjct: 267 catgcagaaggtattggacagaaggagggtctctcagaaa 306


>gnl|LJGI|TC59564 similar to UniRef100_Q76KV2 Cluster: DNA binding with one finger 2
           protein; n=1; Pisum sativum|Rep: DNA binding with one
           finger 2 protein - Pisum sativum (Garden pea), partial
           (69%)
          Length = 1515

 Score =  101 bits (51), Expect = 8e-21
 Identities = 81/91 (89%)
 Strand = Plus / Plus

                                                                       
Query: 194 acaccaagttctgctactacaacaactacagcctctctcagcccaggtacttctgcaaga 253
           ||||||| ||||| ||||||||||||||||||||||| ||||| || |||||||||||| 
Sbjct: 552 acaccaaattctgttactacaacaactacagcctctcccagcctagatacttctgcaagt 611

                                          
Query: 254 cttgcagaaggtattggaccaagggaggaac 284
           ||||||| || || |||||||| ||||||||
Sbjct: 612 cttgcaggagatactggaccaaaggaggaac 642


>gnl|LJGI|TC66125 similar to UniRef100_Q0GLD5 Cluster: Dof17; n=1; Glycine max|Rep:
           Dof17 - Glycine max (Soybean), partial (68%)
          Length = 1682

 Score = 95.6 bits (48), Expect = 5e-19
 Identities = 114/136 (83%)
 Strand = Plus / Plus

                                                                       
Query: 194 acaccaagttctgctactacaacaactacagcctctctcagcccaggtacttctgcaaga 253
           ||||||||||||||||||||||||||||||||||| | || || || |||||||||||||
Sbjct: 770 acaccaagttctgctactacaacaactacagcctcacacaacctagatacttctgcaaga 829

                                                                       
Query: 254 cttgcagaaggtattggaccaagggaggaactctcagaaacatccccgtcggcggaggat 313
           | || |||||||| |||||  | || ||  ||||||||||  |||| || || || || |
Sbjct: 830 catgtagaaggtactggacagaaggtgggtctctcagaaatgtcccagtaggaggtggtt 889

                           
Query: 314 gcagaaagaacaagaa 329
            |||||||||||||||
Sbjct: 890 ccagaaagaacaagaa 905


>gnl|LJGI|TC75151 similar to UniRef100_Q0GLC9 Cluster: Dof22; n=1; Glycine max|Rep:
           Dof22 - Glycine max (Soybean), partial (31%)
          Length = 786

 Score = 91.7 bits (46), Expect = 8e-18
 Identities = 82/94 (87%)
 Strand = Plus / Plus

                                                                       
Query: 158 accaagctctcaagtgcccaaggtgtgactctgcccacaccaagttctgctactacaaca 217
           |||| ||||||||||||||  | ||||||||   | ||||||||||||||||||||||||
Sbjct: 466 accaggctctcaagtgcccccgctgtgactccatcaacaccaagttctgctactacaaca 525

                                             
Query: 218 actacagcctctctcagcccaggtacttctgcaa 251
           |||||| ||||||||||||| |  ||||||||||
Sbjct: 526 actacaacctctctcagccccgccacttctgcaa 559


>gnl|LJGI|TC59646 similar to UniRef100_Q0GLE2 Cluster: Dof10; n=1; Glycine max|Rep:
           Dof10 - Glycine max (Soybean), partial (69%)
          Length = 1723

 Score = 83.8 bits (42), Expect = 2e-15
 Identities = 90/106 (84%)
 Strand = Plus / Plus

                                                                       
Query: 194 acaccaagttctgctactacaacaactacagcctctctcagcccaggtacttctgcaaga 253
           |||||||||||||||||||||||||||||| ||||||||||||  |  | | ||||||||
Sbjct: 311 acaccaagttctgctactacaacaactacaacctctctcagccacgccattactgcaaga 370

                                                         
Query: 254 cttgcagaaggtattggaccaagggaggaactctcagaaacatccc 299
             |||| |||||| |||||||| || ||  | ||||||||||||||
Sbjct: 371 actgcaaaaggtactggaccaaaggtggctccctcagaaacatccc 416


>gnl|LJGI|AW720051 similar to UniRef100_Q0GLE8 Cluster: Dof4; n=1; Glycine max|Rep:
           Dof4 - Glycine max (Soybean), partial (24%)
          Length = 564

 Score = 77.8 bits (39), Expect = 1e-13
 Identities = 42/43 (97%)
 Strand = Plus / Plus

                                                      
Query: 194 acaccaagttctgctactacaacaactacagcctctctcagcc 236
           |||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 164 acaccaagttctgctactacaacaactacaacctctctcagcc 206


>gnl|LJGI|FS336172 similar to UniRef100_Q0GLE5 Cluster: Dof7; n=1; Glycine max|Rep:
           Dof7 - Glycine max (Soybean), partial (75%)
          Length = 765

 Score = 75.8 bits (38), Expect = 5e-13
 Identities = 71/82 (86%)
 Strand = Plus / Plus

                                                                       
Query: 194 acaccaagttctgctactacaacaactacagcctctctcagcccaggtacttctgcaaga 253
           |||||||||||||||||||||||||||||| |||| |||||||  |  ||||||||||||
Sbjct: 191 acaccaagttctgctactacaacaactacaacctcactcagcctcgccacttctgcaaga 250

                                 
Query: 254 cttgcagaaggtattggaccaa 275
           | ||| |  |||| ||||||||
Sbjct: 251 catgccgccggtactggaccaa 272


>gnl|LJGI|DC599444 homologue to UniRef100_Q0GLD5 Cluster: Dof17; n=1; Glycine max|Rep:
           Dof17 - Glycine max (Soybean), partial (15%)
          Length = 463

 Score = 73.8 bits (37), Expect = 2e-12
 Identities = 52/57 (91%)
 Strand = Plus / Plus

                                                                    
Query: 194 acaccaagttctgctactacaacaactacagcctctctcagcccaggtacttctgca 250
           ||||||||||||||||||||||||||||||||||| | || || || ||||||||||
Sbjct: 407 acaccaagttctgctactacaacaactacagcctcacacaacctagatacttctgca 463


>gnl|LJGI|TC64822 similar to UniRef100_Q0GLF0 Cluster: Dof1; n=1; Glycine max|Rep:
           Dof1 - Glycine max (Soybean), partial (40%)
          Length = 790

 Score = 69.9 bits (35), Expect = 3e-11
 Identities = 68/79 (86%)
 Strand = Plus / Plus

                                                                       
Query: 194 acaccaagttctgctactacaacaactacagcctctctcagcccaggtacttctgcaaga 253
           ||||||| |||||||||||||||||||||| |||||| |||||  |  | ||||||||||
Sbjct: 697 acaccaaattctgctactacaacaactacaacctctcacagccgcgccatttctgcaaga 756

                              
Query: 254 cttgcagaaggtattggac 272
            ||||| |||||| |||||
Sbjct: 757 attgcaaaaggtactggac 775


>gnl|LJGI|BP037378 similar to UniRef100_A7PIU8 Cluster: Chromosome chr13 scaffold_17,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr13 scaffold_17, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (22%)
          Length = 514

 Score = 65.9 bits (33), Expect = 5e-10
 Identities = 48/53 (90%)
 Strand = Plus / Plus

                                                                
Query: 202 ttctgctactacaacaactacagcctctctcagcccaggtacttctgcaagac 254
           ||||||||||  ||||||||||||||||| |||||| || |||||||||||||
Sbjct: 254 ttctgctactttaacaactacagcctctcgcagccccggcacttctgcaagac 306


>gnl|LJGI|TC72546 similar to UniRef100_Q76KU9 Cluster: DNA binding with one finger 5
           protein; n=1; Pisum sativum|Rep: DNA binding with one
           finger 5 protein - Pisum sativum (Garden pea), partial
           (37%)
          Length = 725

 Score = 61.9 bits (31), Expect = 7e-09
 Identities = 52/59 (88%)
 Strand = Plus / Plus

                                                                      
Query: 194 acaccaagttctgctactacaacaactacagcctctctcagcccaggtacttctgcaag 252
           |||||||||||||||||||||||||||||| |  |||||||||  |  |||||||||||
Sbjct: 513 acaccaagttctgctactacaacaactacaactactctcagcctcgccacttctgcaag 571


>gnl|LJGI|DC599154 homologue to UniRef100_A7QPU1 Cluster: Chromosome chr10
           scaffold_138, whole genome shotgun sequence; n=1; Vitis
           vinifera|Rep: Chromosome chr10 scaffold_138, whole
           genome shotgun sequence - Vitis vinifera (Grape),
           partial (23%)
          Length = 559

 Score = 56.0 bits (28), Expect = 4e-07
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                       
Query: 181 tgtgactctgcccacaccaagttctgctactacaacaactacag 224
           ||||||||  || ||||||| |||||||||||||||||||||||
Sbjct: 101 tgtgactcaaccaacaccaaattctgctactacaacaactacag 144