Miyakogusa Predicted Gene
- Lj1g3v0409040.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj1g3v0409040.1 Non Chatacterized Hit- tr|I1JX78|I1JX78_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.50326
PE,74.16,0,SUBFAMILY NOT NAMED,NULL; FAMILY NOT NAMED,NULL;
ZF_DOF_2,Zinc finger, Dof-type; seg,NULL; zf-Dof,Zi,CUFF.25662.1
(1032 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|BP080960 homologue to UniRef100_Q3R2H7 Cluster: Fimbria... 133 2e-30
gnl|LJGI|DC599565 similar to UniRef100_Q0GLD8 Cluster: Dof14; n=... 127 1e-28
gnl|LJGI|BP069051 similar to UniRef100_Q0GLD3 Cluster: Dof19; n=... 117 1e-25
gnl|LJGI|TC79148 homologue to UniRef100_Q0GLD5 Cluster: Dof17; n... 103 2e-21
gnl|LJGI|TC61491 similar to UniRef100_Q0GLD5 Cluster: Dof17; n=1... 103 2e-21
gnl|LJGI|TC59564 similar to UniRef100_Q76KV2 Cluster: DNA bindin... 101 8e-21
gnl|LJGI|TC66125 similar to UniRef100_Q0GLD5 Cluster: Dof17; n=1... 96 5e-19
gnl|LJGI|TC75151 similar to UniRef100_Q0GLC9 Cluster: Dof22; n=1... 92 8e-18
gnl|LJGI|TC59646 similar to UniRef100_Q0GLE2 Cluster: Dof10; n=1... 84 2e-15
gnl|LJGI|AW720051 similar to UniRef100_Q0GLE8 Cluster: Dof4; n=1... 78 1e-13
gnl|LJGI|FS336172 similar to UniRef100_Q0GLE5 Cluster: Dof7; n=1... 76 5e-13
gnl|LJGI|DC599444 homologue to UniRef100_Q0GLD5 Cluster: Dof17; ... 74 2e-12
gnl|LJGI|TC64822 similar to UniRef100_Q0GLF0 Cluster: Dof1; n=1;... 70 3e-11
gnl|LJGI|BP037378 similar to UniRef100_A7PIU8 Cluster: Chromosom... 66 5e-10
gnl|LJGI|TC72546 similar to UniRef100_Q76KU9 Cluster: DNA bindin... 62 7e-09
gnl|LJGI|DC599154 homologue to UniRef100_A7QPU1 Cluster: Chromos... 56 4e-07
>gnl|LJGI|BP080960 homologue to UniRef100_Q3R2H7 Cluster: Fimbrial assembly protein;
n=2; Xylella fastidiosa|Rep: Fimbrial assembly protein -
Xylella fastidiosa Ann-1, partial (7%)
Length = 397
Score = 133 bits (67), Expect = 2e-30
Identities = 67/67 (100%)
Strand = Plus / Minus
Query: 966 cggtccaggatcatggactggtggcatgatgaacggctatggatcctccacaaacccttt 1025
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 397 cggtccaggatcatggactggtggcatgatgaacggctatggatcctccacaaacccttt 338
Query: 1026 gatctaa 1032
|||||||
Sbjct: 337 gatctaa 331
>gnl|LJGI|DC599565 similar to UniRef100_Q0GLD8 Cluster: Dof14; n=1; Glycine max|Rep:
Dof14 - Glycine max (Soybean), partial (12%)
Length = 255
Score = 127 bits (64), Expect = 1e-28
Identities = 64/64 (100%)
Strand = Plus / Plus
Query: 1 atgggtttgtcttctcttcacgtttgcatggacacagcagagcattggttacagggcaca 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 192 atgggtttgtcttctcttcacgtttgcatggacacagcagagcattggttacagggcaca 251
Query: 61 attc 64
||||
Sbjct: 252 attc 255
>gnl|LJGI|BP069051 similar to UniRef100_Q0GLD3 Cluster: Dof19; n=1; Glycine max|Rep:
Dof19 - Glycine max (Soybean), partial (44%)
Length = 344
Score = 117 bits (59), Expect = 1e-25
Identities = 74/79 (93%)
Strand = Plus / Minus
Query: 194 acaccaagttctgctactacaacaactacagcctctctcagcccaggtacttctgcaaga 253
||||| |||||||||||||||||||||| |||||| |||||||||||||||||||| |||
Sbjct: 267 acacccagttctgctactacaacaactatagcctcactcagcccaggtacttctgctaga 208
Query: 254 cttgcagaaggtattggac 272
||||||||||||| |||||
Sbjct: 207 cttgcagaaggtactggac 189
>gnl|LJGI|TC79148 homologue to UniRef100_Q0GLD5 Cluster: Dof17; n=1; Glycine max|Rep:
Dof17 - Glycine max (Soybean), partial (32%)
Length = 813
Score = 103 bits (52), Expect = 2e-21
Identities = 88/100 (88%)
Strand = Plus / Plus
Query: 194 acaccaagttctgctactacaacaactacagcctctctcagcccaggtacttctgcaaga 253
|||||||||||||||| |||||||||||||||||| | || || || |||||||||||||
Sbjct: 419 acaccaagttctgctattacaacaactacagcctcacacaaccgagatacttctgcaaga 478
Query: 254 cttgcagaaggtattggaccaagggaggaactctcagaaa 293
| ||||||||||||||||| | ||||| ||||||||||
Sbjct: 479 catgcagaaggtattggacagaaggagggtctctcagaaa 518
>gnl|LJGI|TC61491 similar to UniRef100_Q0GLD5 Cluster: Dof17; n=1; Glycine max|Rep:
Dof17 - Glycine max (Soybean), partial (46%)
Length = 1290
Score = 103 bits (52), Expect = 2e-21
Identities = 88/100 (88%)
Strand = Plus / Plus
Query: 194 acaccaagttctgctactacaacaactacagcctctctcagcccaggtacttctgcaaga 253
|||||||||||||||| |||||||||||||||||| | || || || |||||||||||||
Sbjct: 207 acaccaagttctgctattacaacaactacagcctcacacaaccgagatacttctgcaaga 266
Query: 254 cttgcagaaggtattggaccaagggaggaactctcagaaa 293
| ||||||||||||||||| | ||||| ||||||||||
Sbjct: 267 catgcagaaggtattggacagaaggagggtctctcagaaa 306
>gnl|LJGI|TC59564 similar to UniRef100_Q76KV2 Cluster: DNA binding with one finger 2
protein; n=1; Pisum sativum|Rep: DNA binding with one
finger 2 protein - Pisum sativum (Garden pea), partial
(69%)
Length = 1515
Score = 101 bits (51), Expect = 8e-21
Identities = 81/91 (89%)
Strand = Plus / Plus
Query: 194 acaccaagttctgctactacaacaactacagcctctctcagcccaggtacttctgcaaga 253
||||||| ||||| ||||||||||||||||||||||| ||||| || ||||||||||||
Sbjct: 552 acaccaaattctgttactacaacaactacagcctctcccagcctagatacttctgcaagt 611
Query: 254 cttgcagaaggtattggaccaagggaggaac 284
||||||| || || |||||||| ||||||||
Sbjct: 612 cttgcaggagatactggaccaaaggaggaac 642
>gnl|LJGI|TC66125 similar to UniRef100_Q0GLD5 Cluster: Dof17; n=1; Glycine max|Rep:
Dof17 - Glycine max (Soybean), partial (68%)
Length = 1682
Score = 95.6 bits (48), Expect = 5e-19
Identities = 114/136 (83%)
Strand = Plus / Plus
Query: 194 acaccaagttctgctactacaacaactacagcctctctcagcccaggtacttctgcaaga 253
||||||||||||||||||||||||||||||||||| | || || || |||||||||||||
Sbjct: 770 acaccaagttctgctactacaacaactacagcctcacacaacctagatacttctgcaaga 829
Query: 254 cttgcagaaggtattggaccaagggaggaactctcagaaacatccccgtcggcggaggat 313
| || |||||||| ||||| | || || |||||||||| |||| || || || || |
Sbjct: 830 catgtagaaggtactggacagaaggtgggtctctcagaaatgtcccagtaggaggtggtt 889
Query: 314 gcagaaagaacaagaa 329
|||||||||||||||
Sbjct: 890 ccagaaagaacaagaa 905
>gnl|LJGI|TC75151 similar to UniRef100_Q0GLC9 Cluster: Dof22; n=1; Glycine max|Rep:
Dof22 - Glycine max (Soybean), partial (31%)
Length = 786
Score = 91.7 bits (46), Expect = 8e-18
Identities = 82/94 (87%)
Strand = Plus / Plus
Query: 158 accaagctctcaagtgcccaaggtgtgactctgcccacaccaagttctgctactacaaca 217
|||| |||||||||||||| | |||||||| | ||||||||||||||||||||||||
Sbjct: 466 accaggctctcaagtgcccccgctgtgactccatcaacaccaagttctgctactacaaca 525
Query: 218 actacagcctctctcagcccaggtacttctgcaa 251
|||||| ||||||||||||| | ||||||||||
Sbjct: 526 actacaacctctctcagccccgccacttctgcaa 559
>gnl|LJGI|TC59646 similar to UniRef100_Q0GLE2 Cluster: Dof10; n=1; Glycine max|Rep:
Dof10 - Glycine max (Soybean), partial (69%)
Length = 1723
Score = 83.8 bits (42), Expect = 2e-15
Identities = 90/106 (84%)
Strand = Plus / Plus
Query: 194 acaccaagttctgctactacaacaactacagcctctctcagcccaggtacttctgcaaga 253
|||||||||||||||||||||||||||||| |||||||||||| | | | ||||||||
Sbjct: 311 acaccaagttctgctactacaacaactacaacctctctcagccacgccattactgcaaga 370
Query: 254 cttgcagaaggtattggaccaagggaggaactctcagaaacatccc 299
|||| |||||| |||||||| || || | ||||||||||||||
Sbjct: 371 actgcaaaaggtactggaccaaaggtggctccctcagaaacatccc 416
>gnl|LJGI|AW720051 similar to UniRef100_Q0GLE8 Cluster: Dof4; n=1; Glycine max|Rep:
Dof4 - Glycine max (Soybean), partial (24%)
Length = 564
Score = 77.8 bits (39), Expect = 1e-13
Identities = 42/43 (97%)
Strand = Plus / Plus
Query: 194 acaccaagttctgctactacaacaactacagcctctctcagcc 236
|||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 164 acaccaagttctgctactacaacaactacaacctctctcagcc 206
>gnl|LJGI|FS336172 similar to UniRef100_Q0GLE5 Cluster: Dof7; n=1; Glycine max|Rep:
Dof7 - Glycine max (Soybean), partial (75%)
Length = 765
Score = 75.8 bits (38), Expect = 5e-13
Identities = 71/82 (86%)
Strand = Plus / Plus
Query: 194 acaccaagttctgctactacaacaactacagcctctctcagcccaggtacttctgcaaga 253
|||||||||||||||||||||||||||||| |||| ||||||| | ||||||||||||
Sbjct: 191 acaccaagttctgctactacaacaactacaacctcactcagcctcgccacttctgcaaga 250
Query: 254 cttgcagaaggtattggaccaa 275
| ||| | |||| ||||||||
Sbjct: 251 catgccgccggtactggaccaa 272
>gnl|LJGI|DC599444 homologue to UniRef100_Q0GLD5 Cluster: Dof17; n=1; Glycine max|Rep:
Dof17 - Glycine max (Soybean), partial (15%)
Length = 463
Score = 73.8 bits (37), Expect = 2e-12
Identities = 52/57 (91%)
Strand = Plus / Plus
Query: 194 acaccaagttctgctactacaacaactacagcctctctcagcccaggtacttctgca 250
||||||||||||||||||||||||||||||||||| | || || || ||||||||||
Sbjct: 407 acaccaagttctgctactacaacaactacagcctcacacaacctagatacttctgca 463
>gnl|LJGI|TC64822 similar to UniRef100_Q0GLF0 Cluster: Dof1; n=1; Glycine max|Rep:
Dof1 - Glycine max (Soybean), partial (40%)
Length = 790
Score = 69.9 bits (35), Expect = 3e-11
Identities = 68/79 (86%)
Strand = Plus / Plus
Query: 194 acaccaagttctgctactacaacaactacagcctctctcagcccaggtacttctgcaaga 253
||||||| |||||||||||||||||||||| |||||| ||||| | | ||||||||||
Sbjct: 697 acaccaaattctgctactacaacaactacaacctctcacagccgcgccatttctgcaaga 756
Query: 254 cttgcagaaggtattggac 272
||||| |||||| |||||
Sbjct: 757 attgcaaaaggtactggac 775
>gnl|LJGI|BP037378 similar to UniRef100_A7PIU8 Cluster: Chromosome chr13 scaffold_17,
whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
Chromosome chr13 scaffold_17, whole genome shotgun
sequence - Vitis vinifera (Grape), partial (22%)
Length = 514
Score = 65.9 bits (33), Expect = 5e-10
Identities = 48/53 (90%)
Strand = Plus / Plus
Query: 202 ttctgctactacaacaactacagcctctctcagcccaggtacttctgcaagac 254
|||||||||| ||||||||||||||||| |||||| || |||||||||||||
Sbjct: 254 ttctgctactttaacaactacagcctctcgcagccccggcacttctgcaagac 306
>gnl|LJGI|TC72546 similar to UniRef100_Q76KU9 Cluster: DNA binding with one finger 5
protein; n=1; Pisum sativum|Rep: DNA binding with one
finger 5 protein - Pisum sativum (Garden pea), partial
(37%)
Length = 725
Score = 61.9 bits (31), Expect = 7e-09
Identities = 52/59 (88%)
Strand = Plus / Plus
Query: 194 acaccaagttctgctactacaacaactacagcctctctcagcccaggtacttctgcaag 252
|||||||||||||||||||||||||||||| | ||||||||| | |||||||||||
Sbjct: 513 acaccaagttctgctactacaacaactacaactactctcagcctcgccacttctgcaag 571
>gnl|LJGI|DC599154 homologue to UniRef100_A7QPU1 Cluster: Chromosome chr10
scaffold_138, whole genome shotgun sequence; n=1; Vitis
vinifera|Rep: Chromosome chr10 scaffold_138, whole
genome shotgun sequence - Vitis vinifera (Grape),
partial (23%)
Length = 559
Score = 56.0 bits (28), Expect = 4e-07
Identities = 40/44 (90%)
Strand = Plus / Plus
Query: 181 tgtgactctgcccacaccaagttctgctactacaacaactacag 224
|||||||| || ||||||| |||||||||||||||||||||||
Sbjct: 101 tgtgactcaaccaacaccaaattctgctactacaacaactacag 144