Miyakogusa Predicted Gene

Lj1g3v0342010.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj1g3v0342010.1 Non Chatacterized Hit- tr|I1JXA0|I1JXA0_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.25320
PE,92.79,0,AAA,ATPase, AAA-type, conserved site; AAA,ATPase, AAA-type,
core; CDC48_N,CDC48, N-terminal subdomai,CUFF.25579.1
         (2457 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|AW163981 similar to UniRef100_A9TF08 Cluster: Predicted...    94   5e-18
gnl|LJGI|GO020783 homologue to UniRef100_P54774 Cluster: Cell di...    78   3e-13
gnl|LJGI|BP041402 homologue to UniRef100_P54774 Cluster: Cell di...    60   7e-08
gnl|LJGI|TC75615 homologue to UniRef100_A7PT66 Cluster: Chromoso...    58   3e-07

>gnl|LJGI|AW163981 similar to UniRef100_A9TF08 Cluster: Predicted protein; n=1;
            Physcomitrella patens subsp. patens|Rep: Predicted
            protein - Physcomitrella patens subsp. patens, partial
            (10%)
          Length = 445

 Score = 93.7 bits (47), Expect = 5e-18
 Identities = 83/95 (87%)
 Strand = Plus / Plus

                                                                        
Query: 2227 gtagctgagataaaaccagctcactttgaagagtcaatgaagtttgctcgccggagtgtc 2286
            ||||||||||||||| ||||||||||||||||||||||||| | ||| ||  ||||||| 
Sbjct: 50   gtagctgagataaaagcagctcactttgaagagtcaatgaaatatgcacgaaggagtgta 109

                                               
Query: 2287 agtgatgctgacatcaggaaataccaggtgtttgc 2321
            ||||||||||||||  | || ||||||| ||||||
Sbjct: 110  agtgatgctgacattcgaaagtaccaggcgtttgc 144


>gnl|LJGI|GO020783 homologue to UniRef100_P54774 Cluster: Cell division cycle protein 48
            homolog; n=2; Glycine max|Rep: Cell division cycle
            protein 48 homolog - Glycine max (Soybean), partial (14%)
          Length = 665

 Score = 77.8 bits (39), Expect = 3e-13
 Identities = 63/71 (88%)
 Strand = Plus / Plus

                                                                        
Query: 2074 tacactcagggatttagtggtgctgatattactgaaatttgtcaacgagcttgcaaatat 2133
            |||||||| || || |||||||||||||||||||| ||||| || || ||||||||||||
Sbjct: 20   tacactcaaggcttcagtggtgctgatattactgagatttgccagcgtgcttgcaaatat 79

                       
Query: 2134 gccatcagaga 2144
            ||||| |||||
Sbjct: 80   gccattagaga 90


>gnl|LJGI|BP041402 homologue to UniRef100_P54774 Cluster: Cell division cycle protein
           48 homolog; n=2; Glycine max|Rep: Cell division cycle
           protein 48 homolog - Glycine max (Soybean), partial
           (10%)
          Length = 253

 Score = 60.0 bits (30), Expect = 7e-08
 Identities = 72/86 (83%)
 Strand = Plus / Plus

                                                                       
Query: 331 cttggagatgttgtctctgttcatcaatgtcctgatgtcaagtatgggagtcgagttcac 390
           |||||||||||||| ||||| || || ||  ||||||| ||||||||||| || ||||||
Sbjct: 139 cttggagatgttgtgtctgtgcaccagtgcgctgatgttaagtatgggaggcgtgttcac 198

                                     
Query: 391 atccttccaattgatgatactattga 416
           || || ||  |||||||||| |||||
Sbjct: 199 attctgcctcttgatgataccattga 224


>gnl|LJGI|TC75615 homologue to UniRef100_A7PT66 Cluster: Chromosome chr8 scaffold_29,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr8 scaffold_29, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (26%)
          Length = 689

 Score = 58.0 bits (29), Expect = 3e-07
 Identities = 44/49 (89%)
 Strand = Plus / Plus

                                                            
Query: 329 ggcttggagatgttgtctctgttcatcaatgtcctgatgtcaagtatgg 377
           |||||||||||||||| || || || |||||| ||||||||||||||||
Sbjct: 362 ggcttggagatgttgtttcggtgcaccaatgtgctgatgtcaagtatgg 410