Miyakogusa Predicted Gene
- Lj1g3v0342010.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj1g3v0342010.1 Non Chatacterized Hit- tr|I1JXA0|I1JXA0_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.25320
PE,92.79,0,AAA,ATPase, AAA-type, conserved site; AAA,ATPase, AAA-type,
core; CDC48_N,CDC48, N-terminal subdomai,CUFF.25579.1
(2457 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|AW163981 similar to UniRef100_A9TF08 Cluster: Predicted... 94 5e-18
gnl|LJGI|GO020783 homologue to UniRef100_P54774 Cluster: Cell di... 78 3e-13
gnl|LJGI|BP041402 homologue to UniRef100_P54774 Cluster: Cell di... 60 7e-08
gnl|LJGI|TC75615 homologue to UniRef100_A7PT66 Cluster: Chromoso... 58 3e-07
>gnl|LJGI|AW163981 similar to UniRef100_A9TF08 Cluster: Predicted protein; n=1;
Physcomitrella patens subsp. patens|Rep: Predicted
protein - Physcomitrella patens subsp. patens, partial
(10%)
Length = 445
Score = 93.7 bits (47), Expect = 5e-18
Identities = 83/95 (87%)
Strand = Plus / Plus
Query: 2227 gtagctgagataaaaccagctcactttgaagagtcaatgaagtttgctcgccggagtgtc 2286
||||||||||||||| ||||||||||||||||||||||||| | ||| || |||||||
Sbjct: 50 gtagctgagataaaagcagctcactttgaagagtcaatgaaatatgcacgaaggagtgta 109
Query: 2287 agtgatgctgacatcaggaaataccaggtgtttgc 2321
|||||||||||||| | || ||||||| ||||||
Sbjct: 110 agtgatgctgacattcgaaagtaccaggcgtttgc 144
>gnl|LJGI|GO020783 homologue to UniRef100_P54774 Cluster: Cell division cycle protein 48
homolog; n=2; Glycine max|Rep: Cell division cycle
protein 48 homolog - Glycine max (Soybean), partial (14%)
Length = 665
Score = 77.8 bits (39), Expect = 3e-13
Identities = 63/71 (88%)
Strand = Plus / Plus
Query: 2074 tacactcagggatttagtggtgctgatattactgaaatttgtcaacgagcttgcaaatat 2133
|||||||| || || |||||||||||||||||||| ||||| || || ||||||||||||
Sbjct: 20 tacactcaaggcttcagtggtgctgatattactgagatttgccagcgtgcttgcaaatat 79
Query: 2134 gccatcagaga 2144
||||| |||||
Sbjct: 80 gccattagaga 90
>gnl|LJGI|BP041402 homologue to UniRef100_P54774 Cluster: Cell division cycle protein
48 homolog; n=2; Glycine max|Rep: Cell division cycle
protein 48 homolog - Glycine max (Soybean), partial
(10%)
Length = 253
Score = 60.0 bits (30), Expect = 7e-08
Identities = 72/86 (83%)
Strand = Plus / Plus
Query: 331 cttggagatgttgtctctgttcatcaatgtcctgatgtcaagtatgggagtcgagttcac 390
|||||||||||||| ||||| || || || ||||||| ||||||||||| || ||||||
Sbjct: 139 cttggagatgttgtgtctgtgcaccagtgcgctgatgttaagtatgggaggcgtgttcac 198
Query: 391 atccttccaattgatgatactattga 416
|| || || |||||||||| |||||
Sbjct: 199 attctgcctcttgatgataccattga 224
>gnl|LJGI|TC75615 homologue to UniRef100_A7PT66 Cluster: Chromosome chr8 scaffold_29,
whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
Chromosome chr8 scaffold_29, whole genome shotgun
sequence - Vitis vinifera (Grape), partial (26%)
Length = 689
Score = 58.0 bits (29), Expect = 3e-07
Identities = 44/49 (89%)
Strand = Plus / Plus
Query: 329 ggcttggagatgttgtctctgttcatcaatgtcctgatgtcaagtatgg 377
|||||||||||||||| || || || |||||| ||||||||||||||||
Sbjct: 362 ggcttggagatgttgtttcggtgcaccaatgtgctgatgtcaagtatgg 410