Miyakogusa Predicted Gene

Lj1g3v0271570.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj1g3v0271570.1 Non Chatacterized Hit- tr|I1KC60|I1KC60_SOYBN
Uncharacterized protein OS=Glycine max PE=4 SV=1,81.33,0,seg,NULL;
coiled-coil,NULL,CUFF.25481.1
         (1473 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|BP041750 similar to UniRef100_Q2VY14 Cluster: CONSTANS ...   303   2e-81

>gnl|LJGI|BP041750 similar to UniRef100_Q2VY14 Cluster: CONSTANS interacting protein
           5; n=1; Solanum lycopersicum|Rep: CONSTANS interacting
           protein 5 - Solanum lycopersicum (Tomato) (Lycopersicon
           esculentum), partial (11%)
          Length = 539

 Score =  303 bits (153), Expect = 2e-81
 Identities = 153/153 (100%)
 Strand = Plus / Minus

                                                                       
Query: 1   atgcaggccaagagggtcagtgtggaggagattgagaatggagtgaggactgaaactgat 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 461 atgcaggccaagagggtcagtgtggaggagattgagaatggagtgaggactgaaactgat 402

                                                                       
Query: 61  gatgtgtgcttggataggtacaaggtgtttctgaagcagtacaaggagtgggtggaggca 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 401 gatgtgtgcttggataggtacaaggtgtttctgaagcagtacaaggagtgggtggaggca 342

                                            
Query: 121 aacaaggatagattggaggaggagtcttacgag 153
           |||||||||||||||||||||||||||||||||
Sbjct: 341 aacaaggatagattggaggaggagtcttacgag 309