Miyakogusa Predicted Gene
- Lj1g3v0264390.4
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj1g3v0264390.4 CUFF.25799.4
(309 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|GO012486 homologue to UniRef100_Q6W2J3 Cluster: VDAC1.3... 123 7e-28
gnl|LJGI|TC82682 homologue to UniRef100_Q6W2J3 Cluster: VDAC1.3;... 123 7e-28
gnl|LJGI|DC597999 UniRef100_O22385 Cluster: Glycine-rich protein... 96 2e-19
>gnl|LJGI|GO012486 homologue to UniRef100_Q6W2J3 Cluster: VDAC1.3; n=1; Lotus
japonicus|Rep: VDAC1.3 - Lotus japonicus, partial (11%)
Length = 748
Score = 123 bits (62), Expect = 7e-28
Identities = 78/82 (95%), Gaps = 1/82 (1%)
Strand = Plus / Plus
Query: 4 gcatctctcatagcctgctccgatgcattgatttcatccactcgaccttccaattctctc 63
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
Sbjct: 306 gcatctctcatagcctgctccgatgcattgatttcatcccctcgaccttccaattctctc 365
Query: 64 agaacttcaatgtcatctctca 85
|||||||||| |||||||||
Sbjct: 366 -gaacttcaatcgcatctctca 386
>gnl|LJGI|TC82682 homologue to UniRef100_Q6W2J3 Cluster: VDAC1.3; n=1; Lotus
japonicus|Rep: VDAC1.3 - Lotus japonicus, partial (13%)
Length = 750
Score = 123 bits (62), Expect = 7e-28
Identities = 78/82 (95%), Gaps = 1/82 (1%)
Strand = Plus / Plus
Query: 4 gcatctctcatagcctgctccgatgcattgatttcatccactcgaccttccaattctctc 63
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
Sbjct: 363 gcatctctcatagcctgctccgatgcattgatttcatcccctcgaccttccaattctctc 422
Query: 64 agaacttcaatgtcatctctca 85
|||||||||| |||||||||
Sbjct: 423 -gaacttcaatcgcatctctca 443
>gnl|LJGI|DC597999 UniRef100_O22385 Cluster: Glycine-rich protein; n=1; Oryza
sativa|Rep: Glycine-rich protein - Oryza sativa (Rice),
partial (6%)
Length = 570
Score = 95.6 bits (48), Expect = 2e-19
Identities = 48/48 (100%)
Strand = Plus / Plus
Query: 1 atggcatctctcatagcctgctccgatgcattgatttcatccactcga 48
||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 523 atggcatctctcatagcctgctccgatgcattgatttcatccactcga 570