Miyakogusa Predicted Gene

Lj1g3v0261770.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj1g3v0261770.1 tr|G7KAF7|G7KAF7_MEDTR
2-dehydro-3-deoxyphosphoheptonate aldolase
(3-deoxy-d-arabino-heptulosonate
7,97.3,0.00000000000007,DAHP_synth_2,DAHP synthetase, class
II,NODE_4032_length_66_cov_2644.605957.path1.1
         (111 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC64309 homologue to UniRef100_A7NUV4 Cluster: Chromoso...   220   1e-57
gnl|LJGI|TC61482 similar to UniRef100_O24046 Cluster: 2-dehydro-...   208   5e-54

>gnl|LJGI|TC64309 homologue to UniRef100_A7NUV4 Cluster: Chromosome chr18 scaffold_1,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr18 scaffold_1, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (82%)
          Length = 1590

 Score =  220 bits (111), Expect = 1e-57
 Identities = 111/111 (100%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgcagagggttactcaatggaatctggacttcactcagcagagtgagcagggagatagg 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 510 atgcagagggttactcaatggaatctggacttcactcagcagagtgagcagggagatagg 569

                                                              
Query: 61  taccgagagcttgctaaccgagttgatgaggcccttgggttcatggctgct 111
           |||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 570 taccgagagcttgctaaccgagttgatgaggcccttgggttcatggctgct 620


>gnl|LJGI|TC61482 similar to UniRef100_O24046 Cluster:
            2-dehydro-3-deoxyphosphoheptonate aldolase
            (3-deoxy-d-arabino- heptulosonate 7-phosphate synthase)
            precursor; n=1; Morinda citrifolia|Rep:
            2-dehydro-3-deoxyphosphoheptonate aldolase
            (3-deoxy-d-arabino- heptulosonate 7-phosphate synthase)
            precursor - Morinda citrifolia (Indian mulberry), partial
            (43%)
          Length = 1007

 Score =  208 bits (105), Expect = 5e-54
 Identities = 105/105 (100%)
 Strand = Plus / Plus

                                                                        
Query: 1    atgcagagggttactcaatggaatctggacttcactcagcagagtgagcagggagatagg 60
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 903  atgcagagggttactcaatggaatctggacttcactcagcagagtgagcagggagatagg 962

                                                         
Query: 61   taccgagagcttgctaaccgagttgatgaggcccttgggttcatg 105
            |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 963  taccgagagcttgctaaccgagttgatgaggcccttgggttcatg 1007