Miyakogusa Predicted Gene

Lj1g3v0224270.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj1g3v0224270.1 tr|D7L333|D7L333_ARALL Pectinesterase
OS=Arabidopsis lyrata subsp. lyrata GN=ARALYDRAFT_478847 PE=3
,65.52,0.014, ,gene.g29028.t1.1
         (124 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC61921 similar to UniRef100_Q708X4 Cluster: Pectin met...   115   6e-26

>gnl|LJGI|TC61921 similar to UniRef100_Q708X4 Cluster: Pectin methylesterase; n=1;
           Cicer arietinum|Rep: Pectin methylesterase - Cicer
           arietinum (Chickpea) (Garbanzo), partial (89%)
          Length = 2214

 Score =  115 bits (58), Expect = 6e-26
 Identities = 79/86 (91%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgtgcagcaatgctttggccatggtgaagaacatgttcgattctgatattgcaaatttt 60
           ||||||||||||||||| ||||||| ||||||||||   ||||||||||||||| |||||
Sbjct: 729 atgtgcagcaatgctttagccatggcgaagaacatgactgattctgatattgcagatttt 788

                                     
Query: 61  gagaagaacagtgttgcagggaagaa 86
           ||||||||||||||||||||| ||||
Sbjct: 789 gagaagaacagtgttgcaggggagaa 814