Miyakogusa Predicted Gene

Lj1g3v0129730.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj1g3v0129730.1 Non Chatacterized Hit- tr|I1JLP3|I1JLP3_SOYBN
Uncharacterized protein OS=Glycine max PE=4
SV=1,51.19,0.00000000000003,Chromo domain-like,Chromo domain-like; no
description,NULL; Chromo,Chromo domain; CHROMO_2,Chromo
do,NODE_107301_length_622_cov_7.028939.path1.1
         (258 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|GO040426 similar to UniRef100_A7BS46 Cluster: Transposa...    54   4e-07
gnl|LJGI|TC75813                                                       52   2e-06

>gnl|LJGI|GO040426 similar to UniRef100_A7BS46 Cluster: Transposase, IS4; n=1;
           Beggiatoa sp. PS|Rep: Transposase, IS4 - Beggiatoa sp.
           PS, partial (8%)
          Length = 787

 Score = 54.0 bits (27), Expect = 4e-07
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 166 caccttgaggacaaggtgaagcttttggcgccgggtattgataggat 212
           |||||||||||||||||||| ||||| |  | |||||||||||||||
Sbjct: 317 caccttgaggacaaggtgaatcttttaggacagggtattgataggat 271


>gnl|LJGI|TC75813 
          Length = 1214

 Score = 52.0 bits (26), Expect = 2e-06
 Identities = 29/30 (96%)
 Strand = Plus / Plus

                                         
Query: 102 tttacctacttgtgagaacagttgggaatc 131
           ||||||| ||||||||||||||||||||||
Sbjct: 612 tttacctgcttgtgagaacagttgggaatc 641