Miyakogusa Predicted Gene

Lj1g3v0052160.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj1g3v0052160.1 Non Chatacterized Hit- tr|E5GBH0|E5GBH0_CUCME
Putative uncharacterized protein OS=Cucumis melo
subsp,40.53,3e-19,seg,NULL,CUFF.25146.1
         (609 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC66537 similar to UniRef100_A7QL89 Cluster: Chromosome...    84   1e-15
gnl|LJGI|GO036832                                                      62   4e-09

>gnl|LJGI|TC66537 similar to UniRef100_A7QL89 Cluster: Chromosome chr3 scaffold_117,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr3 scaffold_117, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (16%)
          Length = 958

 Score = 83.8 bits (42), Expect = 1e-15
 Identities = 45/46 (97%)
 Strand = Plus / Plus

                                                         
Query: 206 tgtccatggtttctgatgcttcttctgggcctccacatttctcaca 251
           |||||||||||||||||||||||||||| |||||||||||||||||
Sbjct: 238 tgtccatggtttctgatgcttcttctggacctccacatttctcaca 283


>gnl|LJGI|GO036832 
          Length = 668

 Score = 61.9 bits (31), Expect = 4e-09
 Identities = 37/39 (94%)
 Strand = Plus / Plus

                                                  
Query: 206 tgtccatggtttctgatgcttcttctgggcctccacatt 244
           ||||||||||||| |||||||||||||| ||||||||||
Sbjct: 321 tgtccatggtttcggatgcttcttctggacctccacatt 359