Miyakogusa Predicted Gene

Lj1g3v0014470.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj1g3v0014470.1 Non Chatacterized Hit- tr|B8G434|B8G434_CHLAD
Putative uncharacterized protein (Precursor) OS=Chloro,40.38,9.2,
,CUFF.25277.1
         (217 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|AV779582                                                     111   2e-24

>gnl|LJGI|AV779582 
          Length = 345

 Score =  111 bits (56), Expect = 2e-24
 Identities = 129/152 (84%), Gaps = 1/152 (0%)
 Strand = Plus / Minus

                                                                       
Query: 61  ggtgcacatgggttgggttggatggattttcaagctaatcaggacccgaaccgatcaaaa 120
           |||||||||||||||||||||||||||||  | |||||||| || ||||||| || |  |
Sbjct: 219 ggtgcacatgggttgggttggatggatttataggctaatcatgatccgaacccattacca 160

                                                                       
Query: 121 ctgtttgggttgggttgggttggatttcgtgaattttcacctacgaacccgaaccaaccc 180
            || ||||||||| ||||||||||||||  || ||||||||  || ||||||||| ||||
Sbjct: 159 ttgcttgggttggattgggttggatttcacgagttttcaccctcggacccgaacccaccc 100

                                           
Query: 181 aat-ccgacaatcttcgggttggtttggatgg 211
            || ||||| ||||||||||||||| ||||||
Sbjct: 99  catcccgacgatcttcgggttggttcggatgg 68