Miyakogusa Predicted Gene

Lj1g3v0001070.2
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj1g3v0001070.2 Non Chatacterized Hit- tr|I1JB16|I1JB16_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.47968
PE,70.09,0,seg,NULL; coiled-coil,NULL,CUFF.25145.2
         (2211 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|BP085125                                                     139   8e-32

>gnl|LJGI|BP085125 
          Length = 472

 Score =  139 bits (70), Expect = 8e-32
 Identities = 73/74 (98%)
 Strand = Plus / Minus

                                                                        
Query: 2138 tggatcttgtatcgcatgttgatcagaagcaattgcaagaattggcagtcacacttaatc 2197
            |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 472  tggatcttgtatcgcatgttgatcagaagcgattgcaagaattggcagtcacacttaatc 413

                          
Query: 2198 tatatactgagtga 2211
            ||||||||||||||
Sbjct: 412  tatatactgagtga 399