Miyakogusa Predicted Gene
- Lj0g3v0363619.2
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj0g3v0363619.2 tr|Q0GLD1|Q0GLD1_SOYBN Dof21 OS=Glycine max
GN=Gma.4766 PE=2 SV=1,69.15,0,Q8RVK0_HORVU_Q8RVK0;,Zinc finger,
Dof-type; ZF_DOF_1,Zinc finger, Dof-type; seg,NULL; zf-Dof,Zinc
fi,CUFF.25055.2
(842 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|BP051573 similar to UniRef100_A7QU31 Cluster: Chromosom... 250 1e-65
gnl|LJGI|TC66125 similar to UniRef100_Q0GLD5 Cluster: Dof17; n=1... 135 5e-31
gnl|LJGI|BP069051 similar to UniRef100_Q0GLD3 Cluster: Dof19; n=... 115 5e-25
gnl|LJGI|TC79148 homologue to UniRef100_Q0GLD5 Cluster: Dof17; n... 111 7e-24
gnl|LJGI|TC61491 similar to UniRef100_Q0GLD5 Cluster: Dof17; n=1... 111 7e-24
gnl|LJGI|DC599444 homologue to UniRef100_Q0GLD5 Cluster: Dof17; ... 96 4e-19
gnl|LJGI|TC59564 similar to UniRef100_Q76KV2 Cluster: DNA bindin... 92 7e-18
gnl|LJGI|BP037378 similar to UniRef100_A7PIU8 Cluster: Chromosom... 68 1e-10
gnl|LJGI|DC599154 homologue to UniRef100_A7QPU1 Cluster: Chromos... 66 4e-10
gnl|LJGI|TC67936 similar to UniRef100_A7QU31 Cluster: Chromosome... 66 4e-10
gnl|LJGI|TC64822 similar to UniRef100_Q0GLF0 Cluster: Dof1; n=1;... 64 1e-09
gnl|LJGI|TC59646 similar to UniRef100_Q0GLE2 Cluster: Dof10; n=1... 60 2e-08
gnl|LJGI|TC75151 similar to UniRef100_Q0GLC9 Cluster: Dof22; n=1... 58 9e-08
gnl|LJGI|AW720051 similar to UniRef100_Q0GLE8 Cluster: Dof4; n=1... 56 4e-07
gnl|LJGI|TC69533 similar to UniRef100_A7PDL2 Cluster: Chromosome... 52 6e-06
>gnl|LJGI|BP051573 similar to UniRef100_A7QU31 Cluster: Chromosome chr2 scaffold_176,
whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
Chromosome chr2 scaffold_176, whole genome shotgun
sequence - Vitis vinifera (Grape), partial (11%)
Length = 493
Score = 250 bits (126), Expect = 1e-65
Identities = 126/126 (100%)
Strand = Plus / Minus
Query: 717 gatcttgtttcctgtggaggaattgaagcaacaagttccaaacagtggtgagtttgagca 776
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 493 gatcttgtttcctgtggaggaattgaagcaacaagttccaaacagtggtgagtttgagca 434
Query: 777 gaataggagtcaaggagattcagctgggtattggaatggcatgttaggtggaggatcatg 836
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 433 gaataggagtcaaggagattcagctgggtattggaatggcatgttaggtggaggatcatg 374
Query: 837 gtagat 842
||||||
Sbjct: 373 gtagat 368
>gnl|LJGI|TC66125 similar to UniRef100_Q0GLD5 Cluster: Dof17; n=1; Glycine max|Rep:
Dof17 - Glycine max (Soybean), partial (68%)
Length = 1682
Score = 135 bits (68), Expect = 5e-31
Identities = 137/160 (85%)
Strand = Plus / Plus
Query: 85 aactgtccaaggtgcaattcaaccaacacaaaattctgttactacaacaactacagcctc 144
||||||||||||||||||||||||||||| || ||||| |||||||||||||||||||||
Sbjct: 745 aactgtccaaggtgcaattcaaccaacaccaagttctgctactacaacaactacagcctc 804
Query: 145 tctcagccaaggtacttttgcaagacttgtagaaggtattggactgaaggtggttccttg 204
| || || || ||||| |||||||| ||||||||||| ||||| |||||||| || |
Sbjct: 805 acacaacctagatacttctgcaagacatgtagaaggtactggacagaaggtgggtctctc 864
Query: 205 aggaatgttcctgtgggtggtggctctagaaagaacaaga 244
|| ||||| || || || ||||| || |||||||||||||
Sbjct: 865 agaaatgtcccagtaggaggtggttccagaaagaacaaga 904
>gnl|LJGI|BP069051 similar to UniRef100_Q0GLD3 Cluster: Dof19; n=1; Glycine max|Rep:
Dof19 - Glycine max (Soybean), partial (44%)
Length = 344
Score = 115 bits (58), Expect = 5e-25
Identities = 118/138 (85%)
Strand = Plus / Minus
Query: 57 ggcaaggccacagaaagatcaagctttgaactgtccaaggtgcaattcaaccaacacaaa 116
|||||||||||||| ||| ||||| |||||||||| ||||| | |||| |||||| |
Sbjct: 320 ggcaaggccacagacagaagaagctgtgaactgtcccaggtgtcactcaatcaacaccca 261
Query: 117 attctgttactacaacaactacagcctctctcagccaaggtacttttgcaagacttgtag 176
||||| |||||||||||||| |||||| ||||||| |||||||| ||| ||||||| ||
Sbjct: 260 gttctgctactacaacaactatagcctcactcagcccaggtacttctgctagacttgcag 201
Query: 177 aaggtattggactgaagg 194
|||||| |||||||||||
Sbjct: 200 aaggtactggactgaagg 183
>gnl|LJGI|TC79148 homologue to UniRef100_Q0GLD5 Cluster: Dof17; n=1; Glycine max|Rep:
Dof17 - Glycine max (Soybean), partial (32%)
Length = 813
Score = 111 bits (56), Expect = 7e-24
Identities = 98/112 (87%)
Strand = Plus / Plus
Query: 83 tgaactgtccaaggtgcaattcaaccaacacaaaattctgttactacaacaactacagcc 142
|||| |||||||||||||||||||||||||| || ||||| || ||||||||||||||||
Sbjct: 392 tgaattgtccaaggtgcaattcaaccaacaccaagttctgctattacaacaactacagcc 451
Query: 143 tctctcagccaaggtacttttgcaagacttgtagaaggtattggactgaagg 194
|| | || || || ||||| |||||||| || |||||||||||||| |||||
Sbjct: 452 tcacacaaccgagatacttctgcaagacatgcagaaggtattggacagaagg 503
>gnl|LJGI|TC61491 similar to UniRef100_Q0GLD5 Cluster: Dof17; n=1; Glycine max|Rep:
Dof17 - Glycine max (Soybean), partial (46%)
Length = 1290
Score = 111 bits (56), Expect = 7e-24
Identities = 98/112 (87%)
Strand = Plus / Plus
Query: 83 tgaactgtccaaggtgcaattcaaccaacacaaaattctgttactacaacaactacagcc 142
|||| |||||||||||||||||||||||||| || ||||| || ||||||||||||||||
Sbjct: 180 tgaattgtccaaggtgcaattcaaccaacaccaagttctgctattacaacaactacagcc 239
Query: 143 tctctcagccaaggtacttttgcaagacttgtagaaggtattggactgaagg 194
|| | || || || ||||| |||||||| || |||||||||||||| |||||
Sbjct: 240 tcacacaaccgagatacttctgcaagacatgcagaaggtattggacagaagg 291
>gnl|LJGI|DC599444 homologue to UniRef100_Q0GLD5 Cluster: Dof17; n=1; Glycine max|Rep:
Dof17 - Glycine max (Soybean), partial (15%)
Length = 463
Score = 95.6 bits (48), Expect = 4e-19
Identities = 57/60 (95%)
Strand = Plus / Plus
Query: 85 aactgtccaaggtgcaattcaaccaacacaaaattctgttactacaacaactacagcctc 144
||||||||||||||||||||||||||||| || ||||| |||||||||||||||||||||
Sbjct: 382 aactgtccaaggtgcaattcaaccaacaccaagttctgctactacaacaactacagcctc 441
>gnl|LJGI|TC59564 similar to UniRef100_Q76KV2 Cluster: DNA binding with one finger 2
protein; n=1; Pisum sativum|Rep: DNA binding with one
finger 2 protein - Pisum sativum (Garden pea), partial
(69%)
Length = 1515
Score = 91.7 bits (46), Expect = 7e-18
Identities = 115/138 (83%)
Strand = Plus / Plus
Query: 108 caacacaaaattctgttactacaacaactacagcctctctcagccaaggtacttttgcaa 167
|||||| |||||||||||||||||||||||||||||||| ||||| || ||||| |||||
Sbjct: 550 caacaccaaattctgttactacaacaactacagcctctcccagcctagatacttctgcaa 609
Query: 168 gacttgtagaaggtattggactgaaggtggttccttgaggaatgttcctgtgggtggtgg 227
| |||| || || || ||||| |||| || | ||||||||||||| |||||||| ||
Sbjct: 610 gtcttgcaggagatactggaccaaaggaggaacactgaggaatgttccagtgggtggagg 669
Query: 228 ctctagaaagaacaagag 245
| || |||||||||||
Sbjct: 670 gtgcaggaagaacaagag 687
>gnl|LJGI|BP037378 similar to UniRef100_A7PIU8 Cluster: Chromosome chr13 scaffold_17,
whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
Chromosome chr13 scaffold_17, whole genome shotgun
sequence - Vitis vinifera (Grape), partial (22%)
Length = 514
Score = 67.9 bits (34), Expect = 1e-10
Identities = 61/70 (87%)
Strand = Plus / Plus
Query: 106 accaacacaaaattctgttactacaacaactacagcctctctcagccaaggtacttttgc 165
||||||||||||||||| |||| ||||||||||||||||| ||||| || |||| |||
Sbjct: 242 accaacacaaaattctgctactttaacaactacagcctctcgcagccccggcacttctgc 301
Query: 166 aagacttgta 175
||||| ||||
Sbjct: 302 aagacctgta 311
>gnl|LJGI|DC599154 homologue to UniRef100_A7QPU1 Cluster: Chromosome chr10
scaffold_138, whole genome shotgun sequence; n=1; Vitis
vinifera|Rep: Chromosome chr10 scaffold_138, whole
genome shotgun sequence - Vitis vinifera (Grape),
partial (23%)
Length = 559
Score = 65.9 bits (33), Expect = 4e-10
Identities = 57/65 (87%)
Strand = Plus / Plus
Query: 103 tcaaccaacacaaaattctgttactacaacaactacagcctctctcagccaaggtacttt 162
||||||||||| |||||||| ||||||||||||||||| | || |||||||| |||||
Sbjct: 107 tcaaccaacaccaaattctgctactacaacaactacagtttgtcacagccaagacacttt 166
Query: 163 tgcaa 167
|||||
Sbjct: 167 tgcaa 171
>gnl|LJGI|TC67936 similar to UniRef100_A7QU31 Cluster: Chromosome chr2 scaffold_176,
whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
Chromosome chr2 scaffold_176, whole genome shotgun
sequence - Vitis vinifera (Grape), partial (37%)
Length = 1041
Score = 65.9 bits (33), Expect = 4e-10
Identities = 39/41 (95%)
Strand = Plus / Plus
Query: 787 caaggagattcagctgggtattggaatggcatgttaggtgg 827
||||||||||||||||||||||||| ||| |||||||||||
Sbjct: 481 caaggagattcagctgggtattggagtggaatgttaggtgg 521
>gnl|LJGI|TC64822 similar to UniRef100_Q0GLF0 Cluster: Dof1; n=1; Glycine max|Rep:
Dof1 - Glycine max (Soybean), partial (40%)
Length = 790
Score = 63.9 bits (32), Expect = 1e-09
Identities = 77/92 (83%)
Strand = Plus / Plus
Query: 109 aacacaaaattctgttactacaacaactacagcctctctcagccaaggtacttttgcaag 168
||||| |||||||| |||||||||||||||| |||||| ||||| | | || ||||||
Sbjct: 696 aacaccaaattctgctactacaacaactacaacctctcacagccgcgccatttctgcaag 755
Query: 169 acttgtagaaggtattggactgaaggtggttc 200
| ||| | |||||| |||||| ||||||||||
Sbjct: 756 aattgcaaaaggtactggactaaaggtggttc 787
>gnl|LJGI|TC59646 similar to UniRef100_Q0GLE2 Cluster: Dof10; n=1; Glycine max|Rep:
Dof10 - Glycine max (Soybean), partial (69%)
Length = 1723
Score = 60.0 bits (30), Expect = 2e-08
Identities = 42/46 (91%)
Strand = Plus / Plus
Query: 108 caacacaaaattctgttactacaacaactacagcctctctcagcca 153
|||||| || ||||| |||||||||||||||| |||||||||||||
Sbjct: 309 caacaccaagttctgctactacaacaactacaacctctctcagcca 354
>gnl|LJGI|TC75151 similar to UniRef100_Q0GLC9 Cluster: Dof22; n=1; Glycine max|Rep:
Dof22 - Glycine max (Soybean), partial (31%)
Length = 786
Score = 58.0 bits (29), Expect = 9e-08
Identities = 41/45 (91%)
Strand = Plus / Plus
Query: 108 caacacaaaattctgttactacaacaactacagcctctctcagcc 152
|||||| || ||||| |||||||||||||||| ||||||||||||
Sbjct: 500 caacaccaagttctgctactacaacaactacaacctctctcagcc 544
>gnl|LJGI|AW720051 similar to UniRef100_Q0GLE8 Cluster: Dof4; n=1; Glycine max|Rep:
Dof4 - Glycine max (Soybean), partial (24%)
Length = 564
Score = 56.0 bits (28), Expect = 4e-07
Identities = 40/44 (90%)
Strand = Plus / Plus
Query: 109 aacacaaaattctgttactacaacaactacagcctctctcagcc 152
||||| || ||||| |||||||||||||||| ||||||||||||
Sbjct: 163 aacaccaagttctgctactacaacaactacaacctctctcagcc 206
>gnl|LJGI|TC69533 similar to UniRef100_A7PDL2 Cluster: Chromosome chr17 scaffold_12,
whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
Chromosome chr17 scaffold_12, whole genome shotgun
sequence - Vitis vinifera (Grape), partial (30%)
Length = 934
Score = 52.0 bits (26), Expect = 6e-06
Identities = 29/30 (96%)
Strand = Plus / Plus
Query: 110 acacaaaattctgttactacaacaactaca 139
|||| |||||||||||||||||||||||||
Sbjct: 622 acaccaaattctgttactacaacaactaca 651