Miyakogusa Predicted Gene

Lj0g3v0361699.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0361699.1 Non Chatacterized Hit- tr|I1L2U1|I1L2U1_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.42480
PE,81.18,0,seg,NULL; PROKAR_LIPOPROTEIN,NULL; Branch,Glycosyl
transferase, family 14; GLYCOSYLATION ENZYME-LIKE,CUFF.24915.1
         (525 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC61638 similar to UniRef100_A7P3I6 Cluster: Chromosome...   165   3e-40

>gnl|LJGI|TC61638 similar to UniRef100_A7P3I6 Cluster: Chromosome chr1 scaffold_5,
            whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
            Chromosome chr1 scaffold_5, whole genome shotgun sequence
            - Vitis vinifera (Grape), partial (35%)
          Length = 1244

 Score =  165 bits (83), Expect = 3e-40
 Identities = 240/291 (82%), Gaps = 1/291 (0%)
 Strand = Plus / Plus

                                                                        
Query: 197  ggttgttgctggctatctatcatccgaggaaccgttacctgcttcaccttggaatggatg 256
            |||||||||||||  | ||||||||  |||| || ||||| ||||| |||||||||||||
Sbjct: 847  ggttgttgctggcagtttatcatcctcggaatcggtaccttcttcatcttggaatggatg 906

                                                                        
Query: 257  ctagggatgaagagaggcatgagctggctgctgcagttatgtcggtgccggcaattcggg 316
            || |||||| |||||||   |  ||||||||||| || | ||| |||||||| |||||||
Sbjct: 907  ctggggatgcagagagggcggccctggctgctgctgtgaggtctgtgccggcgattcggg 966

                                                                        
Query: 317  cttttggaaatgttgatgtggtggggaaggctgattatgtgacctacttggggtcctcca 376
            |||| ||||  ||||||||||| || |||||||| |   | ||||| |||||||||||||
Sbjct: 967  ctttcggaac-gttgatgtggtcggtaaggctgagtggattacctatttggggtcctcca 1025

                                                                        
Query: 377  atgttgccatcactctgagggctgctgctatcatgatgaaattggatggtggatggaatt 436
            ||||||||||||||||  | ||||| || || ||| ||||||||||| |||| ||| |||
Sbjct: 1026 atgttgccatcactctccgagctgcggcgattatgctgaaattggatagtgggtgggatt 1085

                                                               
Query: 437  ggtttgtcacattaagcgcgcgagattatcccctcatcacccaggatggta 487
            ||||  |||| || || || || |||||||| |||||||| ||||||||||
Sbjct: 1086 ggttcatcactttgagtgcacgtgattatcctctcatcactcaggatggta 1136