Miyakogusa Predicted Gene

Lj0g3v0359989.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0359989.1 Non Chatacterized Hit- tr|I1MQ36|I1MQ36_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.20023 PE,28.5,8e-19,PPR:
pentatricopeptide repeat domain,Pentatricopeptide repeat;
PPR,Pentatricopeptide repeat; TPR-lik,CUFF.24778.1
         (894 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|GO030841 weakly similar to UniRef100_A7R617 Cluster: Ch...    72   7e-12

>gnl|LJGI|GO030841 weakly similar to UniRef100_A7R617 Cluster: Chromosome undetermined
           scaffold_1129, whole genome shotgun sequence; n=1; Vitis
           vinifera|Rep: Chromosome undetermined scaffold_1129,
           whole genome shotgun sequence - Vitis vinifera (Grape),
           partial (13%)
          Length = 688

 Score = 71.9 bits (36), Expect = 7e-12
 Identities = 57/64 (89%)
 Strand = Plus / Minus

                                                                       
Query: 410 ctaatgttgtaacttacagttctctaattgatggtctgtgcaaatctgggagaatctctt 469
           |||||||||||||||| |||||||| || |||||| |||||||||| |||||||| ||| 
Sbjct: 678 ctaatgttgtaacttatagttctcttatagatggtttgtgcaaatcagggagaatatctg 619

               
Query: 470 atgc 473
           ||||
Sbjct: 618 atgc 615