Miyakogusa Predicted Gene
- Lj0g3v0359769.2
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj0g3v0359769.2 Non Chatacterized Hit- tr|I1KNT0|I1KNT0_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.56401
PE,84.49,0,FAD/NAD(P)-binding domain,NULL; no description,NULL;
SUBFAMILY NOT NAMED,NULL; PHYTOENE DEHYDROGENAS,CUFF.24762.2
(1698 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|FS360814 176 3e-43
gnl|LJGI|TC74145 72 1e-11
>gnl|LJGI|FS360814
Length = 617
Score = 176 bits (89), Expect = 3e-43
Identities = 141/157 (89%), Gaps = 1/157 (0%)
Strand = Plus / Minus
Query: 564 aggagatttgggtgttctttacactgctgcagctagatatgcccc-ttctctttttaagt 622
|||| |||||||||||||||||||||||||||||||||||||||| || |||||||||||
Sbjct: 617 aggatatttgggtgttctttacactgctgcagctagatatgcccccttttctttttaagt 558
Query: 623 cctttgttcaaatggggcctcagggtgctcttggggctacaaaacttctcagacctttca 682
||||| |||||||||||| ||| ||| ||||| ||| ||| ||||||| |||||||||
Sbjct: 557 cctttcttcaaatggggcatcaaggttctcttaaggccacataacttcttagacctttct 498
Query: 683 aggaaatacttgacggtttggaactcaaagacccttt 719
|||||||||||| ||||||||||| |||||||||||
Sbjct: 497 tggaaatacttgatggtttggaactgaaagacccttt 461
Score = 103 bits (52), Expect = 4e-21
Identities = 123/146 (84%), Gaps = 3/146 (2%)
Strand = Plus / Minus
Query: 797 tttacatgtttgctgaatggtacaaacctggatgctgtcttgagtaccctcttgatggaa 856
||||||||||||| ||||||||||||| ||||| ||||||||||||| ||| |||||
Sbjct: 262 tttacatgtttgcagaatggtacaaacttggatcctgtcttgagtactagctttctggaa 203
Query: 857 ctgcagctatagttgatgctctagtacgaggattggagaagtttggcggacgggtttcgc 916
|||||||||| ||||||||||| ||| ||||| |||||||| |||||| | |||| |
Sbjct: 202 ctgcagctattgttgatgctcttgtaggagga---gagaagttgcgcggacagatttctc 146
Query: 917 ttcaaagtcacgctgagaagatcgtt 942
|||| ||||| | ||||||||||||
Sbjct: 145 ttcatagtcatgtcgagaagatcgtt 120
>gnl|LJGI|TC74145
Length = 718
Score = 71.9 bits (36), Expect = 1e-11
Identities = 45/48 (93%)
Strand = Plus / Plus
Query: 797 tttacatgtttgctgaatggtacaaacctggatgctgtcttgagtacc 844
||||||||||||| ||| ||||||||||||||| ||||||||||||||
Sbjct: 218 tttacatgtttgcagaaaggtacaaacctggatcctgtcttgagtacc 265