Miyakogusa Predicted Gene

Lj0g3v0359299.1

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0359299.1 tr|G7JK40|G7JK40_MEDTR Trehalose-phosphate
phosphatase OS=Medicago truncatula GN=MTR_4g101600 PE=4
S,82.72,0,HAD-like,HAD-like domain;
Trehalose_PPase,Trehalose-phosphatase; T6PP:
trehalose-phosphatase,Trehalo,CUFF.24727.1
         (1122 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC64811 similar to UniRef100_Q3ZTF5 Cluster: Trehalose-...    98   1e-19
gnl|LJGI|TC69909 weakly similar to UniRef100_Q3ZTF5 Cluster: Tre...    56   5e-07
gnl|LJGI|TC69753 similar to UniRef100_A7R008 Cluster: Chromosome...    56   5e-07

>gnl|LJGI|TC64811 similar to UniRef100_Q3ZTF5 Cluster: Trehalose-phosphate
           phosphatase; n=1; Nicotiana tabacum|Rep:
           Trehalose-phosphate phosphatase - Nicotiana tabacum
           (Common tobacco), partial (89%)
          Length = 1713

 Score = 97.6 bits (49), Expect = 1e-19
 Identities = 55/57 (96%)
 Strand = Plus / Plus

                                                                    
Query: 537 actaacagaactctactatgctggtagtcatgggatggacattattggccctgttag 593
           ||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||
Sbjct: 754 actaacagaactctattatgctggtagtcatgggatggacatcattggccctgttag 810



 Score = 56.0 bits (28), Expect = 5e-07
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                       
Query: 19  agcagtgacaagaaaacattaaagcggtggttttttatagataa 62
           |||||||||||||||||||| |||  |||||||||||| |||||
Sbjct: 99  agcagtgacaagaaaacattgaagaagtggttttttattgataa 142



 Score = 52.0 bits (26), Expect = 8e-06
 Identities = 77/94 (81%)
 Strand = Plus / Plus

                                                                        
Query: 971  atgtgcttcccatctacattggagatgataaaaccgatgaagatgcattcaaggtgctta 1030
            |||||||||| || || ||||||||||||  ||| ||||||||||| || ||||| || |
Sbjct: 1191 atgtgcttcctatatatattggagatgatcgaacggatgaagatgcgtttaaggttctga 1250

                                              
Query: 1031 gggagagcaatcaaggttatgggattttggtatc 1064
            | ||| | ||| ||||||| ||||| || |||||
Sbjct: 1251 gagaggggaataaaggttacgggatcttagtatc 1284


>gnl|LJGI|TC69909 weakly similar to UniRef100_Q3ZTF5 Cluster: Trehalose-phosphate
           phosphatase; n=1; Nicotiana tabacum|Rep:
           Trehalose-phosphate phosphatase - Nicotiana tabacum
           (Common tobacco), partial (22%)
          Length = 832

 Score = 56.0 bits (28), Expect = 5e-07
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                       
Query: 19  agcagtgacaagaaaacattaaagcggtggttttttatagataa 62
           |||||||||||||||||||| |||  |||||||||||| |||||
Sbjct: 383 agcagtgacaagaaaacattgaagaagtggttttttattgataa 426


>gnl|LJGI|TC69753 similar to UniRef100_A7R008 Cluster: Chromosome chr7 scaffold_294,
            whole genome shotgun sequence; n=2; Vitis vinifera|Rep:
            Chromosome chr7 scaffold_294, whole genome shotgun
            sequence - Vitis vinifera (Grape), partial (77%)
          Length = 1594

 Score = 56.0 bits (28), Expect = 5e-07
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                                
Query: 988  attggagatgataaaaccgatgaagatgcattcaag 1023
            ||||| |||||||| |||||||||||||||||||||
Sbjct: 1105 attggggatgataagaccgatgaagatgcattcaag 1140