Miyakogusa Predicted Gene

Lj0g3v0359049.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0359049.1 tr|G7K6Y7|G7K6Y7_MEDTR Microtubule-associated
protein TORTIFOLIA1 OS=Medicago truncatula
GN=MTR_5g03,70.15,0,seg,NULL; HEAT,HEAT; ARM repeat,Armadillo-type
fold; no description,Armadillo-like helical; FAMILY N,CUFF.24700.1
         (1983 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC63643 similar to UniRef100_A7PD93 Cluster: Chromosome...    58   2e-07

>gnl|LJGI|TC63643 similar to UniRef100_A7PD93 Cluster: Chromosome chr17 scaffold_12,
            whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
            Chromosome chr17 scaffold_12, whole genome shotgun
            sequence - Vitis vinifera (Grape), partial (17%)
          Length = 1213

 Score = 58.0 bits (29), Expect = 2e-07
 Identities = 146/185 (78%)
 Strand = Plus / Plus

                                                                        
Query: 1381 gatttgtctttgatccgtgaacagctaattcaaattgaaaaccagcaatcaaatctatta 1440
            |||||||||||||||||||| ||| || | |||||||| || ||||| ||| ||||  | 
Sbjct: 325  gatttgtctttgatccgtgaccagttactgcaaattgagaagcagcagtcatatcttgtt 384

                                                                        
Query: 1441 gaactcctccagagatttattggaagctcccagactgggatgaattctctggagacacgt 1500
            || || || |||| ||| ||||||||||| || | ||| ||| ||||||| ||||| || 
Sbjct: 385  gatcttctgcagaaattcattggaagctcacaaaatggaatgcattctctagagactcgg 444

                                                                        
Query: 1501 gtatatggtctagagatggccctagatgaaatatcacatgatttggcattatcaagtggc 1560
            ||| |||| || ||| || |  | ||||| || ||  ||||||||||  |||||||||| 
Sbjct: 445  gtacatggccttgagttgtcattggatgagatctcttatgatttggctgtatcaagtgga 504

                 
Query: 1561 aggat 1565
            |||||
Sbjct: 505  aggat 509