Miyakogusa Predicted Gene

Lj0g3v0358999.1

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0358999.1 Non Chatacterized Hit- tr|I1LWX5|I1LWX5_SOYBN
Uncharacterized protein OS=Glycine max PE=4 SV=1,79.64,0,no
description,NULL; no description,Rossmann-like alpha/beta/alpha
sandwich fold; SUBFAMILY NOT NAME,CUFF.24702.1
         (1476 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC70928 homologue to UniRef100_Q8SAG1 Cluster: ATP sulf...    62   1e-08

>gnl|LJGI|TC70928 homologue to UniRef100_Q8SAG1 Cluster: ATP sulfurylase; n=1; Glycine
            max|Rep: ATP sulfurylase - Glycine max (Soybean), partial
            (97%)
          Length = 1979

 Score = 61.9 bits (31), Expect = 1e-08
 Identities = 115/143 (80%)
 Strand = Plus / Plus

                                                                        
Query: 1003 gatggagttcttgatccagagactaccatagtttctatctttccatcacctatgcattat 1062
            ||||| ||||||||||||||||| ||  | || || ||||| || || || ||||| |||
Sbjct: 1107 gatggtgttcttgatccagagacaactgtggtatccatcttcccttctcccatgcactat 1166

                                                                        
Query: 1063 gctggtccaacggaagtgcagtggcacgccaagggacgaataaatgcaggtgctaacttc 1122
            || || ||||| || |||||||||||||| ||||   | || |||||||| || ||||| 
Sbjct: 1167 gccggaccaactgaggtgcagtggcacgcaaaggctaggattaatgcaggggccaacttt 1226

                                   
Query: 1123 tatattgttggtcgtgatcctgc 1145
            || || || ||||||||||||||
Sbjct: 1227 tacatagtcggtcgtgatcctgc 1249