Miyakogusa Predicted Gene

Lj0g3v0357329.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0357329.1 tr|B9I9G4|B9I9G4_POPTR Predicted protein
OS=Populus trichocarpa GN=POPTRDRAFT_572587 PE=4
SV=1,44.2,5e-19,seg,NULL,CUFF.24592.1
         (717 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC73566 similar to UniRef100_A6AWY0 Cluster: Response r...    76   3e-13

>gnl|LJGI|TC73566 similar to UniRef100_A6AWY0 Cluster: Response regulator receiver
           domain protein; n=1; Vibrio parahaemolyticus AQ3810|Rep:
           Response regulator receiver domain protein - Vibrio
           parahaemolyticus AQ3810, partial (5%)
          Length = 863

 Score = 75.8 bits (38), Expect = 3e-13
 Identities = 113/138 (81%)
 Strand = Plus / Plus

                                                                       
Query: 457 agcagcatgttggccatggttttcactgctatcttctgcattgtgataatcttccaaggc 516
           ||||||||||| |||||| |||||||||   ||||||| ||||||||| |  | ||||||
Sbjct: 34  agcagcatgtttgccatgattttcactgtcgtcttctgtattgtgatattacttcaaggc 93

                                                                       
Query: 517 atatcatctggtaaaagctcagtgtcaagtttccagggatctcctctatcaacaggagga 576
           || ||| | || ||||||||||||  ||||||||||| || |||  ||||  ||||||||
Sbjct: 94  atgtcaccaggaaaaagctcagtgaaaagtttccaggaatatccggtatctgcaggagga 153

                             
Query: 577 gcagagggggatttgatt 594
           | |||||| | |||||||
Sbjct: 154 gaagagggtggtttgatt 171