Miyakogusa Predicted Gene

Lj0g3v0354209.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0354209.1 CUFF.24389.1
         (655 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|GO040426 similar to UniRef100_A7BS46 Cluster: Transposa...   103   1e-21
gnl|LJGI|BP037565                                                      82   5e-15
gnl|LJGI|BP037888                                                      76   3e-13
gnl|LJGI|DC598260 weakly similar to UniRef100_Q84ZV5 Cluster: Po...    58   7e-08
gnl|LJGI|TC70517 similar to UniRef100_Q4T357 Cluster: Chromosome...    52   4e-06

>gnl|LJGI|GO040426 similar to UniRef100_A7BS46 Cluster: Transposase, IS4; n=1;
           Beggiatoa sp. PS|Rep: Transposase, IS4 - Beggiatoa sp.
           PS, partial (8%)
          Length = 787

 Score =  103 bits (52), Expect = 1e-21
 Identities = 70/76 (92%)
 Strand = Plus / Minus

                                                                       
Query: 580 caccttgaggacaaggtggatcttttagggcggggtattgataggatgaacagtgcgcgt 639
           |||||||||||||||||| |||||||||| | |||||||||||||||||||||||||| |
Sbjct: 317 caccttgaggacaaggtgaatcttttaggacagggtattgataggatgaacagtgcgcat 258

                           
Query: 640 gaacagtgctcgtgaa 655
           ||||| ||| ||||||
Sbjct: 257 gaacaatgcacgtgaa 242


>gnl|LJGI|BP037565 
          Length = 433

 Score = 81.8 bits (41), Expect = 5e-15
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                        
Query: 580 caccttgaggacaaggtggatcttttagggcggggtattgatagg 624
           ||||||| |||||||||||||||||||||||||||||||||||||
Sbjct: 331 caccttggggacaaggtggatcttttagggcggggtattgatagg 287


>gnl|LJGI|BP037888 
          Length = 522

 Score = 75.8 bits (38), Expect = 3e-13
 Identities = 44/46 (95%)
 Strand = Plus / Minus

                                                         
Query: 580 caccttgaggacaaggtggatcttttagggcggggtattgatagga 625
           ||||||| |||| |||||||||||||||||||||||||||||||||
Sbjct: 368 caccttggggaccaggtggatcttttagggcggggtattgatagga 323


>gnl|LJGI|DC598260 weakly similar to UniRef100_Q84ZV5 Cluster: Polyprotein; n=1;
           Glycine max|Rep: Polyprotein - Glycine max (Soybean),
           partial (4%)
          Length = 560

 Score = 58.0 bits (29), Expect = 7e-08
 Identities = 41/45 (91%)
 Strand = Plus / Plus

                                                        
Query: 582 ccttgaggacaaggtggatcttttagggcggggtattgataggat 626
           ||||||||||||||| | |||||||||| || |||||||||||||
Sbjct: 344 ccttgaggacaaggtcgttcttttaggggggagtattgataggat 388


>gnl|LJGI|TC70517 similar to UniRef100_Q4T357 Cluster: Chromosome undetermined
           SCAF10117, whole genome shotgun sequence; n=1; Tetraodon
           nigroviridis|Rep: Chromosome undetermined SCAF10117,
           whole genome shotgun sequence - Tetraodon nigroviridis
           (Green puffer), partial (3%)
          Length = 550

 Score = 52.0 bits (26), Expect = 4e-06
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                     
Query: 575 cttcccaccttgaggacaaggtggat 600
           ||||||||||||||||||||||||||
Sbjct: 504 cttcccaccttgaggacaaggtggat 479