Miyakogusa Predicted Gene

Lj0g3v0352049.3
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0352049.3 Non Chatacterized Hit- tr|D7T2V4|D7T2V4_VITVI
Putative uncharacterized protein OS=Vitis vinifera
GN=,47.67,0.000000000002,GLYCOSYL HYDROLASE,Glycoside hydrolase,
family 1; Glyco_hydro_1,Glycoside hydrolase, family 1; no
de,CUFF.24214.3
         (507 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|GO030340 similar to UniRef100_A2SY66 Cluster: Vicianin ...   226   1e-58

>gnl|LJGI|GO030340 similar to UniRef100_A2SY66 Cluster: Vicianin hydrolase; n=1; Vicia
           sativa subsp. nigra|Rep: Vicianin hydrolase - Vicia
           angustifolia (Common vetch), partial (41%)
          Length = 725

 Score =  226 bits (114), Expect = 1e-58
 Identities = 198/226 (87%)
 Strand = Plus / Minus

                                                                       
Query: 126 gtttgctcatcccatcacttatggtgactatccccagagtatgagatcttccgtgcgtga 185
           ||||||||||||||| || ||||||||||||||| |||||||||||||||  ||| || |
Sbjct: 725 gtttgctcatcccattacatatggtgactatcccaagagtatgagatctttggtgggtta 666

                                                                       
Query: 186 cagactccccaaagtcacaaaagagcagtctcaaaatctcaaaggttcttatgattttat 245
           ||||||||||||| ||||||||   ||||| |||| |||||||||||||| ||||||| |
Sbjct: 665 cagactccccaaattcacaaaacgacagtcccaaagtctcaaaggttcttctgattttct 606

                                                                       
Query: 246 tggtgtgaattattacacctcatattatgctgaaagtgctgcacctaccagcatcaacaa 305
           ||||||||||||||||||| |||||| |||||||  |  | |||||||||||||||||||
Sbjct: 605 tggtgtgaattattacaccacatattttgctgaacatattccacctaccagcatcaacaa 546

                                                         
Query: 306 gacatattacacagatatgcaagcccatctcagtccgttcaggaat 351
           ||| |||||||  |||||||||||| | ||||||||||| ||||||
Sbjct: 545 gacctattacagggatatgcaagccaaactcagtccgttgaggaat 500