Miyakogusa Predicted Gene

Lj0g3v0352049.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0352049.1 tr|G7IZC8|G7IZC8_MEDTR Beta-glucosidase
OS=Medicago truncatula GN=MTR_3g026620 PE=3 SV=1,79.41,0,GLYCOSYL
HYDROLASE,Glycoside hydrolase, family 1; Glyco_hydro_1,Glycoside
hydrolase, family 1; no de,CUFF.24214.1
         (420 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC63104 similar to UniRef100_A2SY66 Cluster: Vicianin h...   517   e-146
gnl|LJGI|TC58409 similar to UniRef100_A7Q0C8 Cluster: Chromosome...    54   7e-07
gnl|LJGI|FS324075 similar to UniRef100_A8MRZ0 Cluster: Uncharact...    52   3e-06
gnl|LJGI|TC62055 similar to UniRef100_A7Q0C8 Cluster: Chromosome...    52   3e-06
gnl|LJGI|TC60227 similar to UniRef100_A7Q0C8 Cluster: Chromosome...    52   3e-06

>gnl|LJGI|TC63104 similar to UniRef100_A2SY66 Cluster: Vicianin hydrolase; n=1; Vicia
           sativa subsp. nigra|Rep: Vicianin hydrolase - Vicia
           angustifolia (Common vetch), partial (42%)
          Length = 778

 Score =  517 bits (261), Expect = e-146
 Identities = 382/421 (90%), Gaps = 1/421 (0%)
 Strand = Plus / Plus

                                                                       
Query: 1   atggggctggattcattcagattctccatctcatggtccagaatattcccaaagggcaag 60
           ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 345 atggggctggattcattcagattctccatctcatggtccagaatatttccaaagggcaag 404

                                                                       
Query: 61  ggggcagtcaataacttgggggttaaattctacaacgatctcattaatgaggtcctatca 120
           |||  ||||||||| ||||||||||||||||||||| |||||||||||||| ||||||| 
Sbjct: 405 gggagagtcaataaattgggggttaaattctacaacaatctcattaatgagatcctatcc 464

                                                                       
Query: 121 aatggcttaataccttttgtgactatctttcattgggatctcccacaagctcttgaagat 180
           |||||||||| ||||||||||||| |||||||||||||| | ||||||| ||||||||||
Sbjct: 465 aatggcttaacaccttttgtgactctctttcattgggatttgccacaagttcttgaagat 524

                                                                       
Query: 181 gaatatgggggatttctcagtcctaaagtagtggcagattttcatggctatgctgacttt 240
           ||||||||||||||||||  ||||||||||||||  |||||||||| |||||||||| ||
Sbjct: 525 gaatatgggggatttctctctcctaaagtagtgggggattttcatgactatgctgacgtt 584

                                                                       
Query: 241 tgcttcaagacttttggcgaccgggtgaagcattgggtcacactgaatgaaccattttcg 300
           ||||| ||||||||||| ||||| |||||||||||||| |||||||||||||| | ||| 
Sbjct: 585 tgctttaagacttttggtgaccgtgtgaagcattgggtgacactgaatgaaccgtattca 644

                                                                       
Query: 301 tacgctatcaatggttaccatggtggcacctttgcacctggtagatgttctatgtatgtt 360
           ||| | |||||||||||||||||||||||||||||||| |||||||||||||  || |||
Sbjct: 645 tacaccatcaatggttaccatggtggcacctttgcaccgggtagatgttctaactacgtt 704

                                                                       
Query: 361 ggaaattgcaccaccggtgactccgccaccgagcc-tgcattgttggtcacaatttgatt 419
           ||||||||||||  ||||||||| ||||||||||| | ||||||||  ||| ||||||||
Sbjct: 705 ggaaattgcaccttcggtgactcagccaccgagccttacattgttgcccaccatttgatt 764

            
Query: 420 c 420
           |
Sbjct: 765 c 765


>gnl|LJGI|TC58409 similar to UniRef100_A7Q0C8 Cluster: Chromosome chr7 scaffold_42,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr7 scaffold_42, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (40%)
          Length = 910

 Score = 54.0 bits (27), Expect = 7e-07
 Identities = 39/43 (90%)
 Strand = Plus / Plus

                                                      
Query: 151 cattgggatctcccacaagctcttgaagatgaatatgggggat 193
           |||||||| || |||||||| ||||||||||||||||| ||||
Sbjct: 582 cattgggacctaccacaagcacttgaagatgaatatggaggat 624


>gnl|LJGI|FS324075 similar to UniRef100_A8MRZ0 Cluster: Uncharacterized protein
           At1g02850.2; n=1; Arabidopsis thaliana|Rep:
           Uncharacterized protein At1g02850.2 - Arabidopsis
           thaliana (Mouse-ear cress), partial (31%)
          Length = 767

 Score = 52.0 bits (26), Expect = 3e-06
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 150 tcattgggatctcccacaagctcttgaagatgaatatg 187
           ||||||||| || |||||||| ||||||||||||||||
Sbjct: 313 tcattgggacctaccacaagcacttgaagatgaatatg 350


>gnl|LJGI|TC62055 similar to UniRef100_A7Q0C8 Cluster: Chromosome chr7 scaffold_42,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr7 scaffold_42, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (38%)
          Length = 776

 Score = 52.0 bits (26), Expect = 3e-06
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 150 tcattgggatctcccacaagctcttgaagatgaatatg 187
           ||||||||| || |||||||| ||||||||||||||||
Sbjct: 372 tcattgggacctaccacaagcacttgaagatgaatatg 409


>gnl|LJGI|TC60227 similar to UniRef100_A7Q0C8 Cluster: Chromosome chr7 scaffold_42,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr7 scaffold_42, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (32%)
          Length = 852

 Score = 52.0 bits (26), Expect = 3e-06
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 150 tcattgggatctcccacaagctcttgaagatgaatatg 187
           ||||||||| || |||||||| ||||||||||||||||
Sbjct: 389 tcattgggacctaccacaagcacttgaagatgaatatg 426