Miyakogusa Predicted Gene

Lj0g3v0351789.1

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0351789.1 Non Chatacterized Hit- tr|I1KFK2|I1KFK2_SOYBN
Uncharacterized protein OS=Glycine max PE=4 SV=1,63.31,0,no
description,NULL; seg,NULL; DISEASERSIST,Disease resistance protein;
CG2471-PA (LP11415P),NULL; L,CUFF.24185.1
         (2845 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|FS326265 weakly similar to UniRef100_A7PG71 Cluster: Ch...    88   4e-16
gnl|LJGI|DC598101 weakly similar to UniRef100_A7PG71 Cluster: Ch...    70   8e-11

>gnl|LJGI|FS326265 weakly similar to UniRef100_A7PG71 Cluster: Chromosome chr6
           scaffold_15, whole genome shotgun sequence; n=1; Vitis
           vinifera|Rep: Chromosome chr6 scaffold_15, whole genome
           shotgun sequence - Vitis vinifera (Grape), partial (11%)
          Length = 603

 Score = 87.7 bits (44), Expect = 4e-16
 Identities = 103/123 (83%), Gaps = 6/123 (4%)
 Strand = Plus / Plus

                                                                       
Query: 96  agacatcaaagatgaacttgagagcattcaagctttcctcaaagatgcagatagaagagc 155
           |||||| ||||||||||| || ||||| ||||| |||||||| |||||||||||||||||
Sbjct: 124 agacattaaagatgaactagaaagcatccaagccttcctcaaggatgcagatagaagagc 183

                                                                       
Query: 156 ttccacagatgaagcaggtgccagtgaaggaatcaaaacatgggtgaagcaggtgagaga 215
           | |  ||||||||| |      ||||||||| | ||||||||||||||||| |||||| |
Sbjct: 184 tgcagcagatgaagga------agtgaaggagtgaaaacatgggtgaagcaagtgagaca 237

              
Query: 216 agt 218
           |||
Sbjct: 238 agt 240


>gnl|LJGI|DC598101 weakly similar to UniRef100_A7PG71 Cluster: Chromosome chr6
           scaffold_15, whole genome shotgun sequence; n=1; Vitis
           vinifera|Rep: Chromosome chr6 scaffold_15, whole genome
           shotgun sequence - Vitis vinifera (Grape), partial (7%)
          Length = 574

 Score = 69.9 bits (35), Expect = 8e-11
 Identities = 127/157 (80%), Gaps = 3/157 (1%)
 Strand = Plus / Plus

                                                                       
Query: 97  gacatcaaagatgaacttgagagcattcaagctttcctcaaagatgcagatagaagagct 156
           ||||| ||||||||||| || | ||||  ||| |||||||||||||||||||| |  |||
Sbjct: 191 gacataaaagatgaactagaaatcattttagccttcctcaaagatgcagataggaaggct 250

                                                                       
Query: 157 tccacagatgaagcaggtgccagtgaaggaatcaaaacatgggtgaagcaggtgagagaa 216
           ||   ||||||||   || | |  || ||||| ||||| |||||||||||| ||||||||
Sbjct: 251 tc---agatgaagggagttcaaaagatggaataaaaacttgggtgaagcagctgagagaa 307

                                                
Query: 217 gtctctttttgcatagaagatgtgattgatgagtaca 253
            | |||||| | ||||||||||| |||| ||||||||
Sbjct: 308 ttgtcttttcgtatagaagatgtcattgctgagtaca 344