Miyakogusa Predicted Gene

Lj0g3v0351729.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0351729.1 Non Chatacterized Hit- tr|I1KFK8|I1KFK8_SOYBN
Uncharacterized protein OS=Glycine max PE=4 SV=1,76.2,0,seg,NULL;
PROTEIN_KINASE_ST,Serine/threonine-protein kinase, active site;
Serine/Threonine protein k,CUFF.24178.1
         (1668 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|GO038155 similar to UniRef100_Q1S5J1 Cluster: Protein k...   151   2e-35
gnl|LJGI|TC60125 similar to UniRef100_A7PXP7 Cluster: Chromosome...    74   3e-12

>gnl|LJGI|GO038155 similar to UniRef100_Q1S5J1 Cluster: Protein kinase; n=1; Medicago
            truncatula|Rep: Protein kinase - Medicago truncatula
            (Barrel medic), partial (35%)
          Length = 477

 Score =  151 bits (76), Expect = 2e-35
 Identities = 121/136 (88%)
 Strand = Plus / Minus

                                                                        
Query: 1510 acttatggatacatgtctccagagtatgctatggaagggttgtattcagtgaaatctgat 1569
            ||||| ||||||||| ||||||| |||||||||| ||| || | ||||||||||||||||
Sbjct: 440  acttacggatacatggctccagaatatgctatggcaggcttattttcagtgaaatctgat 381

                                                                        
Query: 1570 gttttcagctttggagttcttttactagaaatcatttgtgggaaaagaaacagtggattc 1629
            ||||||||||||||||||||| || |||||||||||| ||||||||||||  ||| ||||
Sbjct: 380  gttttcagctttggagttcttctattagaaatcatttatgggaaaagaaatggtgaattc 321

                            
Query: 1630 tatcttgcagaacatg 1645
            | |||| |||||||||
Sbjct: 320  tttctttcagaacatg 305


>gnl|LJGI|TC60125 similar to UniRef100_A7PXP7 Cluster: Chromosome chr12 scaffold_36,
            whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
            Chromosome chr12 scaffold_36, whole genome shotgun
            sequence - Vitis vinifera (Grape), partial (40%)
          Length = 1519

 Score = 73.8 bits (37), Expect = 3e-12
 Identities = 82/97 (84%)
 Strand = Plus / Plus

                                                                        
Query: 1361 aagactctagactaagagtaatccatagagatttgaaagctagcaatgttctcctggatc 1420
            ||||||||||||||||||||||||| ||||| |||||| |||||||  ||||  | ||| 
Sbjct: 689  aagactctagactaagagtaatccacagagacttgaaaactagcaacattcttttagatg 748

                                                 
Query: 1421 aagagatgaatcccaaaatttcagattttggattggc 1457
              |||||| | || ||||||||||| |||||||||||
Sbjct: 749  gtgagatgcaaccaaaaatttcagactttggattggc 785