Miyakogusa Predicted Gene
- Lj0g3v0351339.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj0g3v0351339.1 CUFF.24183.1
(306 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|BW604002 similar to UniRef100_Q8H2B9 Cluster: 60s acidi... 76 1e-13
gnl|LJGI|TC71812 homologue to UniRef100_Q9FFC0 Cluster: Histone ... 76 1e-13
>gnl|LJGI|BW604002 similar to UniRef100_Q8H2B9 Cluster: 60s acidic ribosomal protein;
n=1; Prunus dulcis|Rep: 60s acidic ribosomal protein -
Prunus dulcis (Almond) (Prunus amygdalus), partial (87%)
Length = 483
Score = 75.8 bits (38), Expect = 1e-13
Identities = 38/38 (100%)
Strand = Plus / Plus
Query: 1 atgggtgacctcctgggaagtcctcgtgttgcatcccc 38
||||||||||||||||||||||||||||||||||||||
Sbjct: 90 atgggtgacctcctgggaagtcctcgtgttgcatcccc 127
>gnl|LJGI|TC71812 homologue to UniRef100_Q9FFC0 Cluster: Histone H2B.10; n=2;
Arabidopsis thaliana|Rep: Histone H2B.10 - Arabidopsis
thaliana (Mouse-ear cress), partial (97%)
Length = 707
Score = 75.8 bits (38), Expect = 1e-13
Identities = 38/38 (100%)
Strand = Plus / Plus
Query: 1 atgggtgacctcctgggaagtcctcgtgttgcatcccc 38
||||||||||||||||||||||||||||||||||||||
Sbjct: 40 atgggtgacctcctgggaagtcctcgtgttgcatcccc 77