Miyakogusa Predicted Gene

Lj0g3v0351109.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0351109.1 Non Chatacterized Hit- tr|Q8W4K0|Q8W4K0_ARATH
Putative uncharacterized protein At4g14190
OS=Arabidop,37.82,0.0000000000004,seg,NULL; ZINC_FINGER_C2H2_1,Zinc
finger, C2H2,CUFF.24129.1
         (2298 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC74230 homologue to UniRef100_A7JWS5 Cluster: Dihydrol...    60   6e-08
gnl|LJGI|TC69944                                                       60   6e-08

>gnl|LJGI|TC74230 homologue to UniRef100_A7JWS5 Cluster: Dihydrolipoyllysine-residue
           acetyltransferase; n=1; Mannheimia haemolytica
           PHL213|Rep: Dihydrolipoyllysine-residue
           acetyltransferase - Mannheimia haemolytica PHL213,
           partial (8%)
          Length = 585

 Score = 60.0 bits (30), Expect = 6e-08
 Identities = 33/34 (97%)
 Strand = Plus / Plus

                                             
Query: 350 gtttggactcaacttctgatgtggtgataatcaa 383
           |||||||||||||| |||||||||||||||||||
Sbjct: 116 gtttggactcaactactgatgtggtgataatcaa 149


>gnl|LJGI|TC69944 
          Length = 565

 Score = 60.0 bits (30), Expect = 6e-08
 Identities = 33/34 (97%)
 Strand = Plus / Plus

                                             
Query: 350 gtttggactcaacttctgatgtggtgataatcaa 383
           |||||||||||||| |||||||||||||||||||
Sbjct: 390 gtttggactcaactactgatgtggtgataatcaa 423