Miyakogusa Predicted Gene

Lj0g3v0350739.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0350739.1 tr|G7KYI0|G7KYI0_MEDTR ATP-dependent DNA helicase
PIF1 OS=Medicago truncatula GN=MTR_7g098990 PE=4 S,40.48,0.58,
,54309_g.1
         (127 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC64383                                                      125   6e-29
gnl|LJGI|BW595832                                                      70   3e-12

>gnl|LJGI|TC64383 
          Length = 862

 Score =  125 bits (63), Expect = 6e-29
 Identities = 111/127 (87%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgaaattgtctaaaaacattgggctagccgcagctaagacaactgatgaagtaaaagaa 60
           |||||||||||||| |||||  ||||| ||||| || | || |||||||||| |||||||
Sbjct: 641 atgaaattgtctaagaacatgcggctaaccgcaactgaaacgactgatgaagcaaaagaa 700

                                                                       
Query: 61  atcaaagagtttgcagattggattcttaaaattgaaaatgacgatcatcctgattttgga 120
           |||||| |||||||| ||||||||||||||||||||| ||  ||||||||||||| | ||
Sbjct: 701 atcaaaaagtttgcatattggattcttaaaattgaaattggtgatcatcctgattctaga 760

                  
Query: 121 gcaggag 127
           |||||||
Sbjct: 761 gcaggag 767


>gnl|LJGI|BW595832 
          Length = 457

 Score = 69.9 bits (35), Expect = 3e-12
 Identities = 38/39 (97%)
 Strand = Plus / Plus

                                                  
Query: 77  attggattcttaaaattgaaaatgacgatcatcctgatt 115
           |||||||||||||||||||||||||||||||| ||||||
Sbjct: 34  attggattcttaaaattgaaaatgacgatcattctgatt 72