Miyakogusa Predicted Gene

Lj0g3v0350729.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0350729.1 tr|Q6BJ62|Q6BJ62_DEBHA DEHA2G04906p
OS=Debaryomyces hansenii (strain ATCC 36239 / CBS 767 / JCM
1990,31.65,0.91,seg,NULL,CUFF.24093.1
         (415 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|FS341218 similar to UniRef100_A3LTK0 Cluster: Predicted...    66   2e-10

>gnl|LJGI|FS341218 similar to UniRef100_A3LTK0 Cluster: Predicted protein; n=1; Pichia
           stipitis|Rep: Predicted protein - Pichia stipitis
           (Yeast), partial (2%)
          Length = 791

 Score = 65.9 bits (33), Expect = 2e-10
 Identities = 39/41 (95%)
 Strand = Plus / Minus

                                                    
Query: 1   atgcagactttggttcagattggagaatcaaaacaaagaaa 41
           |||||||||||||||||||||||||| ||| ||||||||||
Sbjct: 605 atgcagactttggttcagattggagattcacaacaaagaaa 565